Labshake search
Citations for Illumina :
1 - 50 of 378 citations for Recombinant Human Complement Factor H His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... size selected and tagged by Illumina sequencing adapters ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and sequencing (Illumina Hi-Seq) were performed by Iridian Genomes ...
-
bioRxiv - Genetics 2022Quote: ... For NGS (Illumina Hi seq), these quantified DNA samples were sent to the Novo gene (leading-edge genomics services and solutions).
-
bioRxiv - Systems Biology 2019Quote: ... converted to the reverse-complement stranded Illumina sequencing library using the ScriptSeq Complete Kit (Bacteria, Illumina) and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre ...
-
bioRxiv - Genomics 2020Quote: ... and Hi-C sequencing (Illumina sequencing). The tissue samples were stored in liquid nitrogen before sequencing ...
-
bioRxiv - Genomics 2019Quote: Raw Nanopore and Hi-C (Illumina) reads have been deposited in the NCBI SRA and are under the BioProject (PRJNA565796) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... as well as Hi-C (Illumina) chromatin interaction data ...
-
bioRxiv - Molecular Biology 2020Quote: ... pooled and sequenced (Hi-Seq 4000, Illumina). Reads from the sequencer were demultiplexed using bcl2fastq (v2.20.0) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pooled and sequenced (Hi-Seq 2500, Illumina). Reads from the sequencer were demultiplexed using bcl2fastq (v2.20.0) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Hi-C sequencing was performed by Illumina HiSeq 2500 platform ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were sequenced on Hi-Seq2500 (Illumina) obtaining 2×50 paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... but tagged with specific adapters (Illumina, San Diego, USA). Each reaction mixture contained 12.5 µl Kapa HiFi HotStart ReadyMix (Roche ...
-
bioRxiv - Cell Biology 2024Quote: Cells were collected and tagged with Tn5 transposase (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... All Hi-C libraries were sequenced by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Immunology 2023Quote: ... Samples were sequenced on HI-Seq 2500 (Illumina). 11 nucleotide adaptors were trimmed from each read and resultant sequences were aligned to the mm10 genome using bowtie2 (Langmead and Salzberg ...
-
bioRxiv - Immunology 2024Quote: ... then sequenced using Hi-seq 4000 sequencer (Illumina).
-
bioRxiv - Genomics 2021Quote: ... As it is not recommended to use the tandem complement barcodes on the Novaseq platform (Illumina tech support, pers. comm.), only 9,120 of the 9,216 possible barcode combinations can be used out of the barcode v0 design barcodes.
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Immunology 2019Quote: ... and sequenced on an Hi-Seq 2500 platform (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The sequencing was processed on Hi-SEQ 2000 (Illumina) as single-end 50 base reads ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and prepared individually tagged 100bp “TruSeq DNA PCR-free” libraries (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... were analyzed by Illumina Hi-Seq 2500 system (Illumina, Inc., San Diego, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with NSQ 500 hi-Output KT v2 (75 CTS, Illumina). The sequencing reads were aligned to the GRCm38 v84 Ensembl Mus musculus genome using STAR v.2.5.2a with default parameters ...
-
bioRxiv - Genomics 2019Quote: ... The amplified cDNAs were sequenced using Hi-Seq2000 (Illumina, Inc.) and the sequenced cDNAs were mapped to the C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Library sequencing was carried out on a Hi-seq4000 (Illumina) according to the method described by Pertea et al ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Microbiology 2021Quote: ... Each library was uniquely tagged using the Nextera XT indexing primers (Illumina). Paired-end sequencing was performed at the Australian Centre of Ecogenomics ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were separately tagged and sequenced on a HiSeq or NovaSeq (Illumina). We filtered read pairs that contained Illumina adaptor sequences with Trimmomatic v ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was tagged and multiplexed with the Nextera XT DNA kit (Illumina). Whole-genome sequencing of K ...
-
bioRxiv - Genomics 2019Quote: ... Hi-C libraries were prepared for sequencing on HiSeq 4000 (Illumina). After sequencing ...
-
bioRxiv - Immunology 2020Quote: ... 100-cycle sequencing was performed on a Hi-seq 4000 (Illumina) to achieve an average 40× coverage.
-
bioRxiv - Plant Biology 2019Quote: ... Samples were subjected to UMI-tagged sequencing using a NextSeq 500 system (Illumina). The process closely followed the method described by Kubo et al10 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons for each sample were tagged using Nextera XT Index Kits (Illumina, Inc.), multiplexed and sequenced on an Illumina MiSeq next-generation sequencing platform (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... double-sided cleaned tagged libraries were sequenced on NovaSeq 6000 (Illumina, CA, USA) using a 2 × 250 bp paired end sequencing run ...
-
bioRxiv - Genomics 2019Quote: ... and the Hi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Genomics 2020Quote: ... pooled and sequenced on a Next-seq instrument (Illumina Hi-Seq 4000) using 50 cycles paired-end mode.
-
bioRxiv - Genomics 2019Quote: ... A single replicate was sequenced (Illumina Hi-Seq 2000, DKFZ, Heidelberg, Germany). Hi-C QC information is available in supplementary table 4.
-
bioRxiv - Genetics 2021Quote: ... the Hi-Seq 2500 or the Novaseq (Illumina, Inc. San Diego, CA). DNA samples were sequenced to a mean depth of 30x to ensure that all variants were captured.
-
bioRxiv - Genomics 2022Quote: ... Samples were pooled by volume using an index correction factor (from Illumina technical note “Balancing sample coverage for whole-genome sequencing and its associated index correction values”) ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was fragmented and tagged for multiplexing with NexteraXT DNA Sample Preparation Kits (Illumina) and sequenced at PHE on a HiSeq 2500 yielding 100 bp paired end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of each primer tagged with Nextera XT adapter (Illumina, San Diego, USA) and 1ul of DNA template ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... tagged cDNA libraries were generated using the TruSeq Stranded mRNA Sample Preparation Kit (Illumina) following manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... 500ng of PCR amplicons were fragmented and tagged with Illumina DNA Prep (Illumina #20060060). Tagged DNA fragments were further PCR amplified using Read1-TnME ...
-
bioRxiv - Genomics 2022Quote: ... H) DNA re-sequencing by Illumina NovaSeq.
-
bioRxiv - Genetics 2020Quote: ... cDNA libraries were then sequenced using an Illumina Hi-Seq 2500/NOVA (Illumina).