Labshake search
Citations for Illumina :
1 - 50 of 892 citations for Recombinant Human Complement Component 5a Receptor 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
bioRxiv - Genomics 2019Quote: ... (2) receptors obtained from Illumina sequencing of the transcriptome of the main olfactory epithelium ...
-
bioRxiv - Developmental Biology 2019Quote: ... ATAC used components from the Nextera DNA Library Preparation Kit (Illumina) as described previously (Buenrostro et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... size selected and tagged by Illumina sequencing adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of each primer tagged with Nextera XT adapter (Illumina, San Diego, USA) and 1ul of DNA template ...
-
bioRxiv - Developmental Biology 2023Quote: Ribosomal RNAs were depleted from 1 µg of total RNA using TruSeq Stranded Total RNA kit Ribo-Zero components (Illumina) according to the manufacturer’ s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and sequencing (Illumina Hi-Seq) were performed by Iridian Genomes ...
-
bioRxiv - Genetics 2022Quote: ... For NGS (Illumina Hi seq), these quantified DNA samples were sent to the Novo gene (leading-edge genomics services and solutions).
-
bioRxiv - Systems Biology 2019Quote: ... converted to the reverse-complement stranded Illumina sequencing library using the ScriptSeq Complete Kit (Bacteria, Illumina) and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre ...
-
bioRxiv - Genetics 2019Quote: A principal components analysis (PCA) on genome-wide genotyped SNPs (Illumina Infinium Omni2.5) was conducted to model continuous axes of genetic variation within the GRaD sample using EIGENSTRAT and is a common method used to correct for differences in genetic substructure across ethnic groups (Cook & Morris ...
-
bioRxiv - Genomics 2020Quote: ... and Hi-C sequencing (Illumina sequencing). The tissue samples were stored in liquid nitrogen before sequencing ...
-
bioRxiv - Genomics 2019Quote: Raw Nanopore and Hi-C (Illumina) reads have been deposited in the NCBI SRA and are under the BioProject (PRJNA565796) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... as well as Hi-C (Illumina) chromatin interaction data ...
-
bioRxiv - Molecular Biology 2020Quote: ... pooled and sequenced (Hi-Seq 4000, Illumina). Reads from the sequencer were demultiplexed using bcl2fastq (v2.20.0) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pooled and sequenced (Hi-Seq 2500, Illumina). Reads from the sequencer were demultiplexed using bcl2fastq (v2.20.0) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Hi-C sequencing was performed by Illumina HiSeq 2500 platform ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were sequenced on Hi-Seq2500 (Illumina) obtaining 2×50 paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... but tagged with specific adapters (Illumina, San Diego, USA). Each reaction mixture contained 12.5 µl Kapa HiFi HotStart ReadyMix (Roche ...
-
bioRxiv - Cell Biology 2024Quote: Cells were collected and tagged with Tn5 transposase (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... we first extracted the SVs at chromosome level merged and normalized multi-sample VCF files with MAF >= 0.05 using bcftools (v1.15.1) and then used principal component analysis module of AKT (v0.3.3) (https://github.com/Illumina/akt) on the extracted variants using the following command.
-
bioRxiv - Cancer Biology 2021Quote: ... All Hi-C libraries were sequenced by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Immunology 2023Quote: ... Samples were sequenced on HI-Seq 2500 (Illumina). 11 nucleotide adaptors were trimmed from each read and resultant sequences were aligned to the mm10 genome using bowtie2 (Langmead and Salzberg ...
-
bioRxiv - Immunology 2024Quote: ... then sequenced using Hi-seq 4000 sequencer (Illumina).
-
bioRxiv - Genomics 2021Quote: ... As it is not recommended to use the tandem complement barcodes on the Novaseq platform (Illumina tech support, pers. comm.), only 9,120 of the 9,216 possible barcode combinations can be used out of the barcode v0 design barcodes.
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Immunology 2019Quote: ... and sequenced on an Hi-Seq 2500 platform (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The sequencing was processed on Hi-SEQ 2000 (Illumina) as single-end 50 base reads ...
-
bioRxiv - Physiology 2023Quote: Image analyses and base calling were performed using the NovaSeq Control Software and Real-Time Analysis component (Illumina). Demultiplexing was performed using Illumina’s conversion software (bcl2fastq 2.20) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and prepared individually tagged 100bp “TruSeq DNA PCR-free” libraries (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... were analyzed by Illumina Hi-Seq 2500 system (Illumina, Inc., San Diego, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with NSQ 500 hi-Output KT v2 (75 CTS, Illumina). The sequencing reads were aligned to the GRCm38 v84 Ensembl Mus musculus genome using STAR v.2.5.2a with default parameters ...
-
bioRxiv - Genomics 2019Quote: ... The amplified cDNAs were sequenced using Hi-Seq2000 (Illumina, Inc.) and the sequenced cDNAs were mapped to the C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Library sequencing was carried out on a Hi-seq4000 (Illumina) according to the method described by Pertea et al ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Cell Biology 2021Quote: Image analyses and base calling were performed using the NovaSeq Control Software and the Real-Time Analysis component (Illumina). Demultiplexing was performed using the 10X Genomics software Cellranger mkfastq (v3.1.0 for experiment 1 and v6.0.1 for experiment 2) ...
-
bioRxiv - Genomics 2021Quote: ... sex and 20 genetic principal components (derived from multidimensional scaling of genotype data from the Illumina 610-Quadv1 array).
-
bioRxiv - Molecular Biology 2019Quote: ... The samples were then transferred on to the ice and the components (15 μl Blunt ligase master mix, 2.5 μl NEB Next adaptor for Illumina, and 1 μl ligation enhancer to a total volume of 83.5 μl ...
-
bioRxiv - Physiology 2023Quote: Image analyses and base calling were performed using NovaSeq Control Software and the Real-Time Analysis component (Illumina, USA). Demultiplexing was performed using Illumina’s conversion software (bcl2fastq 2.20) ...
-
bioRxiv - Genomics 2023Quote: ... Image analyses and base calling were performed using the Miniseq Control Software and the Real-Time Analysis component (Illumina). Demultiplexing was performed using Illumina’s conversion software (bcl2fastq 2.20.0.422) ...
-
bioRxiv - Genomics 2023Quote: ... using the single read 100 nt protocol on 1 lane of a flow cell SP.Image analyses and base calling were performed using the Miniseq Control Software and the Real-Time Analysis component (Illumina). Demultiplexing was performed using Illumina’s conversion software (bcl2fastq 2.20.0.422) ...
-
bioRxiv - Microbiology 2021Quote: ... Each library was uniquely tagged using the Nextera XT indexing primers (Illumina). Paired-end sequencing was performed at the Australian Centre of Ecogenomics ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were separately tagged and sequenced on a HiSeq or NovaSeq (Illumina). We filtered read pairs that contained Illumina adaptor sequences with Trimmomatic v ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was tagged and multiplexed with the Nextera XT DNA kit (Illumina). Whole-genome sequencing of K ...
-
bioRxiv - Genomics 2019Quote: ... Hi-C libraries were prepared for sequencing on HiSeq 4000 (Illumina). After sequencing ...
-
bioRxiv - Immunology 2020Quote: ... 100-cycle sequencing was performed on a Hi-seq 4000 (Illumina) to achieve an average 40× coverage.
-
bioRxiv - Plant Biology 2019Quote: ... Samples were subjected to UMI-tagged sequencing using a NextSeq 500 system (Illumina). The process closely followed the method described by Kubo et al10 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons for each sample were tagged using Nextera XT Index Kits (Illumina, Inc.), multiplexed and sequenced on an Illumina MiSeq next-generation sequencing platform (Illumina ...