Labshake search
Citations for Illumina :
1 - 50 of 442 citations for Recombinant HBV X Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... HiSeq X (Illumina) operated by HiSeq Control Software v3.3.76 ...
-
bioRxiv - Cell Biology 2024Quote: ... or HiSeq X (Illumina). The adapter sequence was trimmed using cutadapt-1.1255 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... HiSeq X Ten (Illumina, California). Sequence assembly was carried out using the Velvet Optimizer (Zerbino and Birney 2008) ...
-
bioRxiv - Cancer Biology 2022Quote: ... A HiSeq X machine (Illumina) was used for 150 bp paired-end sequencing ...
-
bioRxiv - Genetics 2024Quote: ... HuRef (Illumina HiSeq X Five) and of Korean ancestry ...
-
bioRxiv - Cancer Biology 2024Quote: ... HiSeq X Ten (Illumina, USA), or NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: Paired-end sequencing (2 x 150 bp) was performed with HiSeq X-Ten instruments (Illumina). Two lanes ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Genomics 2020Quote: ... Illumina HiSeq X Ten platform (Illumina) was used to perform sequencing with a read length of 150 bp for each end ...
-
bioRxiv - Molecular Biology 2022Quote: ... and sequencing with HiSeq X (Illumina) were performed by AnnoRoad Co.,Ltd (China).
-
bioRxiv - Microbiology 2020Quote: ... using a HiSeq X sequencing platform (Illumina) generating ∼5 Gb of paired-end reads with 150-bp read length (accession number ...
-
bioRxiv - Microbiology 2021Quote: ... alcaligenes was performed using HiSeq X (Illumina), and the isolate KAM426 was further sequenced using MinION [Oxford Nanopore Technologies (ONT)] with the R9.4.1 flow cell ...
-
bioRxiv - Cancer Biology 2019Quote: Samples were sequenced using HiSeq X (Illumina) and NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: Samples were sequenced using HiSeq X (Illumina). Hashing libraries were sequenced with spike-ins of 2.5%.
-
bioRxiv - Genetics 2022Quote: ... Normalised DNA libraries were clustered on Illumina cBot then sequenced using Illumina HiSeq X Ten platform using HiSeq X Ten Reagent Kit v2.5 kits (FC-501-2501, Illumina). Paired end sequencing was performed using the 2×150bp chemistry to achieve an average output of approximately >120 Gb of data per library.
-
bioRxiv - Genomics 2020Quote: ... Libraries were subsequently sequenced (2 x 150 bp or 2 x 200 bp paired-end reads) using a MiSeq (Illumina) equipment.
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Cancer Biology 2021Quote: ... then sequenced by Genewiz with HiSeq-X (Illumina) 75 BP PE sequencing.
-
bioRxiv - Developmental Biology 2019Quote: ... Libraries were sequenced on a HiSeq X (Illumina) by Novogene (Sacramenta ...
-
bioRxiv - Genetics 2022Quote: ... sequencing platform (Illumina HiSeq 2000 or HiSeq X), sequencing protocol (PCR-based or PCR-free ...
-
bioRxiv - Genetics 2022Quote: ... sequencing platform (Illumina HiSeq 2000 or HiSeq X), sex ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were sequenced on a HiSeq X (Illumina) with paired-end reads of 28 cycles for read 1 and 91 cycles for read 2.
-
bioRxiv - Plant Biology 2021Quote: ... and sequenced on HiSeq X Ten (Illumina, USA) with PE 150 method.
-
bioRxiv - Genomics 2019Quote: ... Libraries were sequenced on HiSeq X machines (Illumina) to genrerate paired-end 2×150 base pair reads ...
-
bioRxiv - Microbiology 2021Quote: ... and sequencing (2 x 150 bp; Illumina HiSeq3000) at a 4-5 million reads per sample were performed by the Max Planck-Genome Center ...
-
bioRxiv - Microbiology 2019Quote: ... paired end reads of 150nt x 2 (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... The library was sequenced on HiSeq X (Illumina) platforms.
-
bioRxiv - Pathology 2021Quote: ... Libraries were sequenced by HiSeq X Ten (Illumina) system.
-
bioRxiv - Genomics 2021Quote: ... and sequencing on HiSeq X device (Illumina, USA) using PE-150 mode ...
-
bioRxiv - Genomics 2020Quote: ... sequenced on one lane of HiSeq X (Illumina). One of the DNA preps inferred to have HMW DNA was used to prepare a linked reads Chromium library (10x genomics ...
-
bioRxiv - Genetics 2022Quote: ... single lane on a HiSeq X flowcell (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: DNA libraries were sequenced on HiSeq X (Illumina) with a paired-end 150-bp option.
-
bioRxiv - Genetics 2023Quote: ... Sequencing was performed using HiSeq X Ten (Illumina). The data were aligned to GRCm38 mm10 using HISAT2-2.1.0 ...
-
bioRxiv - Genomics 2023Quote: ... For the NovaSeq X (Illumina, Inc, California, USA), 34uL of the pooled libraries with a concentration of 0.55 nM were loaded into a lane of a NovaSeq X Series 10B Reagent Kit (300 Cycle ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced on a Novaseq X instrument (Illumina) performing a 2X151bp run ...
-
bioRxiv - Genetics 2024Quote: ... and sequencing (Illumina HiSeq 2 x 150 bp) of the control sample were completed by GENEWIZ (New Jersey ...
-
bioRxiv - Genetics 2024Quote: ... KOREF (Illumina HiSeq X Ten / PacBio_SMRT Sequel II) and executed ntRoot (v1.0.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... using 2 x 100bp paired-end reads and 2 x 8bp or 2 x 12bp index reads with a 300-cycle kit (Illumina 20012860).
-
bioRxiv - Developmental Biology 2020Quote: Libraries were sequenced on an Illumina HiSeq X™ using HiSeq X™ Five Reagent Kit v2(Illumina, Cat# FC-502-2021).
-
bioRxiv - Microbiology 2021Quote: Resistome enriched libraries and unenriched metagenomic libraries were sequenced on an Illumina HiSeq X Ten using a HiSeq X Ten Reagent Kit v2.5 (300 cycles) (Illumina, San Diego, CA) to obtain PE150 reads ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced by HiSeq X (Illumina, San Diego, CA) on a 150 bp paired-end run ...
-
bioRxiv - Genomics 2019Quote: ... the sequencing platform (Illumina HiSeq 2000 or HiSeq X), sex ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... franciscae strain CBS2926T (Illumina, PE 2 x 100 bp) were sequenced and assembled at INRAE Montpellier ...
-
bioRxiv - Cell Biology 2020Quote: ... Libraries were then sequenced on HiSeq X Ten (Illumina) with 150-bp pair-end strategies.
-
bioRxiv - Immunology 2021Quote: ... Generated libraries were sequenced on a HiSeq X (Illumina).
-
bioRxiv - Immunology 2022Quote: ... and RNA sequencing (Illumina HiSeq, 2 x 150 bp).
-
bioRxiv - Cancer Biology 2022Quote: ... and sequenced using a Hiseq X Ten sequencer (Illumina). RNA-seq reads were aligned to a human transcriptome (GRCh38 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The library was sequenced on a HiSeq X (Illumina) platform to obtain 151 nt-long paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... for whole-genome sequencing on a Hiseq X (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: DNA libraries were sequenced on the HiSeq X (Illumina) platform with the paired- end 150-nt option.