Labshake search
Citations for Illumina :
1 - 50 of 3798 citations for RNA Binding Motif Protein 45 RBM45 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Small RNA libraries were prepared from ∼20–45 nt total RNAs using Small RNA Library Preparation kit (Illumina) and analyzed by Illumina HiSeq 2500 platform.
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Genomics 2022Quote: ... we excluded any motif with Phred quality score lower or equal to 30 (Illumina) or 73.17 (HiFi) ...
-
bioRxiv - Developmental Biology 2023Quote: ... were demultiplexed and transformed into fastq files using 10x Cellranger pipeline version 3.1.0 [45] and bcl2fastq v2.19.0.316 (Illumina). The resulting matrices were loaded into the Seurat package v4.0.1 [46] for R v4.0.2 [47] applying standard quality control ...
-
bioRxiv - Microbiology 2023Quote: ... RNAs extracted from immunoprecipitated complexes using Ago2 and GFP antibody were used to generate small RNA sequencing libraries using TruSeq Small RNA Kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The forward primer included a P5 sequence (for binding the Illumina flow cell) followed by a Illumina sequencing primer binding site ...
-
bioRxiv - Molecular Biology 2020Quote: ... the reverse primer included a P7 sequence (for binding the Illumina flow cell) followed by a 6-nt i7-index sequence ...
-
bioRxiv - Genomics 2023Quote: ... and 1.25µM indexing primers (Ad1_noMX primer and Ad2.x indexing primer 45 or IDT for Illumina dual index primers (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and 1.25µM indexing primers (Ad1_noMX primer and Ad2.x indexing primer 45 or IDT for Illumina dual index primers (Illumina, Nextera DNA UD Indexes Set A Ref 20025019) ...
-
bioRxiv - Cell Biology 2020Quote: Libraries were paired-end sequenced (PE5: 45 bp and PE7: 35 bp) on a NextSeq 500 platform using a High Output kit (75 cycles, Illumina). Sequences were demultiplexed using indices and barcodes ...
-
bioRxiv - Bioengineering 2019Quote: ... For library amplification 12 PCR cycles were applied and 45-48 libraries were pooled for sequencing on HiSeq 2000 or HiSeq 2500 instruments (Illumina) using 50 base pair single end reads.
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed for 40 cycles (15 s at 95°C and 45 s at 60°C) using a Thunderbird SYBR Green Polymerase Kit (TOYOBO) and Eco Real-Time PCR System (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Bioengineering 2022Quote: ... libraries were pooled at a ratio of 80% cellular RNA to 20% oligonucleotide barcoded antibodies and sequenced with NextSeq 1000/2000 kit (Illumina) using the following read length ...
-
bioRxiv - Genomics 2019Quote: ... RNA-Seq libraries were prepared from extracted total RNA using the TruSeq Stranded Total RNA RNA Library Prep kit (Illumina), following depletion of ribosomal RNA ...
-
bioRxiv - Genomics 2020Quote: ... Strand-specific total RNA-seq libraries from ribosomal RNA-depleted RNA were prepared using the TruSeq Stranded Total RNA Library kit (Illumina) according to the manufacturer-supplied protocol ...
-
bioRxiv - Systems Biology 2021Quote: ... Strand-specific total RNA-seq libraries from ribosomal RNA-depleted RNA were prepared using the TruSeq Stranded Total RNA Library Prep kit (Illumina) according to the manufacturer-supplied protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA library was prepared with TruSeq Stranded Total RNA (Degraded RNA) v2 RNA Exome Library and TS RNA Access capture protocol (Illumina), and RNA expression passing quality control was quantified with Salmon and normalized in log-normalized counts before ssGSEA calculation ...
-
bioRxiv - Genomics 2019Quote: ... and then incubated with 5 μl of Tn5 Transposase of TTE Mix V50 in 45 μL of 1 x TTBL buffer (TruePrep® DNA Library Prep kit V2 for Illumina®, Vazyme, China) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was depleted of ribosomal RNA (Ribozero, Illumina) and used for generation of stranded RNA sequencing libraries ...
-
bioRxiv - Genetics 2024Quote: ... RNA sequencing (RNA-seq) was performed by Illumina NovaSeq 6000 ...
-
bioRxiv - Microbiology 2023Quote: ... second BsmBI site (producing cut-edge between the base pairing region and dCas9 handle binding region) and read2 (Illumina sequencing element) was amplified from pPEPZ-sgRNAclone (Addgene# 141090 ...
-
bioRxiv - Genetics 2019Quote: ... The total RNA was processed for RNA-seq by TruSeq RNA sample pre kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
bioRxiv - Cancer Biology 2022Quote: RNA sequencing (RNA-seq) libraries were prepared using the TruSeq RNA Sample Preparation Kit v2 (Illumina) using the stranded protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RNA-seq libraries of polyadenylated RNA were prepared using the TruSeq RNA Library Prep Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA libraries for RNA sequencing were constructed using the Truseq stranded total RNA kit (Illumina Inc.) which converts the RNA in a total RNA sample into a library of template molecules of known strand origin ...
-
bioRxiv - Genetics 2021Quote: ... Ribosomal RNA-depleted stranded RNA libraries were prepared using the TruSeq Stranded Total RNA Prep Kit (Illumina) and 500ng of total RNA as input ...
-
bioRxiv - Genomics 2020Quote: ... RNA-seq libraries were prepared from total RNA using TruSeq Stranded Total RNA Library Prep kit (Illumina) according to the manufacturer’s instructions where the first-strand cDNA was synthesized using SuperScript II Reverse Transcriptase (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: Total RNA purified from immature inflorescences was used to generate small RNA libraries (TruSeq small RNA; Illumina), which were sequenced on an Illumina HiSeq 2500 instrument at Fasteris S.A ...
-
bioRxiv - Immunology 2021Quote: ... RNA-Seq libraries were prepared by using 200ng total RNA with TruSeq RNA sample prep kit (Illumina). Oligo(dT)-enriched mRNAs were fragmented randomly with fragmentation buffer ...
-
bioRxiv - Immunology 2019Quote: ... RNA-seq libraries were generated from 300 ng total RNA with an RNA Sample Prep Kit (Illumina) according to a standard protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted using TRIzol and RNA-seq libraries were prepared using TruSeq RNA Library Prep (Illumina) following the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: Polyadenylated RNA was extracted from 10 ug total RNA per sample using TruSeq RNA purification beads (Illumina) and eluted in 15 uL H2O.
-
bioRxiv - Microbiology 2020Quote: RNA-seq libraries of polyadenylated RNA were prepared using the TruSeq RNA Library Prep Kit v2 (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: RNA-seq was performed using total RNA after ribosomal RNA depletion (Ribo-Zero rRNA Removal Kit, Illumina) from 3 brain ...
-
bioRxiv - Microbiology 2020Quote: ... RNA-seq libraries of polyadenylated RNA were prepared using the TruSeq RNA Library Prep Kit v2 (Illumina) or TruSeq Stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... RNA-seq libraries of polyadenylated RNA were prepared with the TruSeq RNA Library Prep Kit v2 (Illumina) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were generated using TruSeq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75bp paired-end sequencing method (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was processed for RNA-seq analysis with the TruSeq RNA Library Prep Kit v2 (Illumina) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75□bp paired-end sequencing method (Illumina ...
-
bioRxiv - Physiology 2023Quote: ... RNA libraries were performed TrueSeq Small RNA Library preparation (Illumina) and were sequenced for 45 cycles on Illumina HiSeq 2000 platform (1 × 75bp read length) ...
-
bioRxiv - Neuroscience 2024Quote: ... High-throughput RNA sequencing (RNA-seq) was performed by Illumina NovaSeq 6000 at Novogene (CA ...
-
bioRxiv - Genomics 2020Quote: ... RNA adapters (Illumina) were ligated to the fragmented DNA followed by cleanup using sample purification beads (SPB ...
-
bioRxiv - Genomics 2020Quote: ... RNA-Seq libraries were prepared from isolated total RNA using TruSeq Stranded Total RNA Library Prep kit (Illumina) according to the manufacturer’s instructions where first strand cDNA was synthesized using SuperScript II Reverse Transcriptase (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA-seq libraries were prepared from > 1 μg of total RNA using TruSeq RNA sample prep kit (Illumina) according to the manufacturers’ instructions.
-
bioRxiv - Plant Biology 2021Quote: ... Strand-specific RNA-seq libraries were prepared from each RNA sample using the TruSeq RNA kit from Illumina according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... treated total RNA were used to generate barcoded small RNA libraries using the Truseq small RNA protocol (Illumina). PCR amplified cDNA libraries were run on 6% Novex TBE gels (Illumina) ...
-
bioRxiv - Physiology 2023Quote: ... RNA-seq libraries were prepared from 500ng of RNA using TruSeq stranded total RNA library preparation kit (Illumina) and barcoded libraries were combined and submitted for sequencing (paired-end 50 cycles on a HiSeq6000 ...