Labshake search
Citations for Illumina :
1 - 50 of 2484 citations for Mono 3 Carboxypropyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... the genome FASTA file was augmented with ERCC sequences to create a STAR genome index with 99 bp overhangs (optimized for Illumina 2 × 100 bp paired-end reads). Two-pass mapping was executed ...
-
bioRxiv - Genetics 2022Quote: ... Pooled RPFs were diluted to 100 ng/uL and 1 ug was used as input for rRNA depletion using RiboZero Gold (part of Illumina 20020598, San Diego, CA) per manufacturer protocol ...
-
bioRxiv - Genomics 2019Quote: ... We reverse transcribed 1 ug of total RNA with the partial P7 adapter (Illumina_4N_21T) and dNTPs with the addition of spiked-in azido-nucleotides (AzVTPs ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 ug of RNA was used to prepare a cDNA library using TruSeq RNA Library Prep Kit v2 (Illumina). Sequencing was performed on an Illumina HiSeq 1500 System in a 1×50 bp single read mode ...
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were prepared from 1 ug of RNA following TruSeq Stranded Total RNA kit (Illumina) with two technical replicates for each sample ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 ug of total RNA were processed for rRNA depletion by Ribozero Gold rRNA Removal kit (Human/Mouse/Rat) (Illumina) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Neuroscience 2023Quote: ... 2×100 bases paired-end (Novaseq 6000, Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were prepared from 1 ug RNA (TruSeq Stranded Total RNA Library Prep Kit, Illumina) and 100 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA libraries were prepared from 1 ug RNA (TruSeq Stranded Total RNA Library Prep Kit, Illumina) and 100 bp ...
-
bioRxiv - Cancer Biology 2021Quote: ... Concurrently 1 ug total RNA was prepped for RNA sequencing according to the manufacturer’s instructions (Illumina). Analysis was performed as described previously1 ...
-
bioRxiv - Genetics 2020Quote: ... Sequencing libraries were generated from total RNA (1 ug) using the TruSeq stranded mRNA kit (Illumina Corp.) and were sequenced using a NovaSeq6000 S4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... franciscae strain CBS2926T (Illumina, PE 2 x 100 bp) were sequenced and assembled at INRAE Montpellier ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Immunology 2023Quote: ... The samples were sequenced in a paired-end run (read 1: 28bp, read 2: 91bp) on a NovaSeq6000 platform using S1 v1.5 (100 cycles) sequencing kits (Illumina). Bcl2fastq software (v2.20.0.422 ...
-
bioRxiv - Microbiology 2022Quote: ... RNA-Seq libraries were prepared using 1 ug of total RNA with TruSeq Stranded mRNA Library Prep kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Paired-end (2×100) sequencing was performed on a HiSeq (Illumina) by Novogene.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Indexed RNA-Seq libraries were prepared from ~1 ug of total RNA using the TruSeq RNA Library Prep Kit v2 (Illumina) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 ug of DNA was processed according to manufacturer instructions (Paired-End DNA sample Prep Kit – Illumina – PE-930-1001), except that DNA was ligated to custom-made adapters for 4 hours at RT ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Physiology 2021Quote: ... High-throughput genome sequencing was performed on a HiSeq 2500 (2 × 100 or 2 × 150 paired-end reads) or MiSeq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 2 µl aliquot of the denatured library pool is then added to 1 ml of HT1 (Illumina), mixed and 120 µl is added to the ‘sample library’ cBot strip tube ...
-
bioRxiv - Developmental Biology 2019Quote: ... or 6 bp (Nextera Index Read 1 Primer/i7) additional base pairs to the 3’ ends of standard Nextera primer sequences [100] (Illumina Inc., San Diego, California). Although we have not confirmed this directly ...
-
bioRxiv - Genetics 2023Quote: ... was used to isolate total RNA and approximately 1 ug of RNA was processed with the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) to prepare libraries for paired-end sequencing on Nova-seq 6000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or paired-end (2 × 100 bp) on the Novaseq 6000 platform (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mono-nucleosomal DNAs were subjected to sequencing using a TruSeq DNA library prep kit (FC-121-2001, Illumina). The final libraries were sequenced using an Illumina HiSeq 2500 platform ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 ug of treated RNA was then input into the Illumina TruSeq Small RNA Library Preparation Kit (Illumina; Cat #: RS-200-0012) with 11 cycles of PCR amplification ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for sequencing using 1 ug of genomic DNA following the TruSeq PCR free kit protocol (Illumina, FC-121-3001). Resulting libraries were quality checked on an Agilent DNA 1000 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... using NextSeq 500/550 v2.5 sequencing reagent kit (read length: 2 × 75 bp) or NovaSeq S1 sequencing reagent kit (read length: 2 × 100 bp) (Illumina) respectively ...
-
bioRxiv - Genomics 2019Quote: Libraries were prepared using NexteraXT and paired-end sequenced on the MiSeq (v3, 2×300 cycles) or iSeq 100 (I1, 2×150 cycles) platforms according to manufacturer instructions (Illumina Inc). All sequences were deposited in the SRA under accession number PRJNA561185.
-
bioRxiv - Developmental Biology 2021Quote: ... 25 mL of 2x NEBNext Ultra II Q5 Master Mix, 3 mL of 10 mM Universal PCR primer from Illumina, 3 mL of 10mM Index PCR primer and 9 mL of nuclease-free water and amplified for 10 cycles (98C for 10 s ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in 2 × 100 nt manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Genomics 2020Quote: ... Sequencing was performed using 2×100 bp paired-end mode on HiSeq 4000 (Illumina) in Genomed SA (Warsaw ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing (2 x 100 bp) was carried out with HiSeq 4000 (Illumina), pooling two patients’ samples on one lane ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... sequencing was run in the rapid run flow cell and paired-end sequenced (read 1 – 26 bp, read 2 – 100 bp) on a HiSeq 1500 (Illumina, San Diego, CA 92122 USA).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA quality was determined and 1 ug RNA was used in library preparation using TruSeq RNA library preparation kit (Illumina, cat no RS-122-2001). Library preparation was performed according manufacturers protocol ...
-
bioRxiv - Genomics 2020Quote: ... Paired-reads (2×100 bp) were sequenced on the NovaSeq 6000 S2 flowcell (Illumina, Inc.). DNA and RNA library preparation and sequencing were performed at the SNP&SEQ Technology Platform in Uppsala ...