Labshake search
Citations for Illumina :
1 - 50 of 2059 citations for Mono 2 Ethyl 5 Hydroxyhexyl Phthalate 13C4 99% Dehp Metabolite Ix 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... the genome FASTA file was augmented with ERCC sequences to create a STAR genome index with 99 bp overhangs (optimized for Illumina 2 × 100 bp paired-end reads). Two-pass mapping was executed ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genomics 2019Quote: ... Ribosomal RNA (rRNA) was depleted from 5 ug of total RNA using the Ribo-ZeroTM Gold Kit (Illumina, Inc). Depleted mRNA was fragmented and converted to first-strand cDNA using Superscript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 ug of RNA was used to prepare a cDNA library using TruSeq RNA Library Prep Kit v2 (Illumina). Sequencing was performed on an Illumina HiSeq 1500 System in a 1×50 bp single read mode ...
-
bioRxiv - Microbiology 2021Quote: PCR free shotgun libraries were prepared for each sample from 2.5 ug metagenomic DNAs by Exeter Sequencing Service for the metagenomic sequencing using the TruSeq DNA library Prep Kit (Illumina). The libraries were sequenced to approximately 7GBp using the HiSeq 2500 rapid run mode (2X 250 bp paired end ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Molecular Biology 2019Quote: ... 2 ug of total RNA were processed for rRNA depletion by Ribozero Gold rRNA Removal kit (Human/Mouse/Rat) (Illumina) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Neuroscience 2023Quote: ... 2×100 bases paired-end (Novaseq 6000, Illumina).
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicon library pool was diluted to 2 nM with sodium hydroxide and 5 mL were transferred into 995mL HT1 (Illumina) to give a final concentration of 10 pM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... franciscae strain CBS2926T (Illumina, PE 2 x 100 bp) were sequenced and assembled at INRAE Montpellier ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Genetics 2022Quote: ... Pooled RPFs were diluted to 100 ng/uL and 1 ug was used as input for rRNA depletion using RiboZero Gold (part of Illumina 20020598, San Diego, CA) per manufacturer protocol ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina, Illumina, San Diego, CA, USA). Transcriptome sequencing was performed using the Illumina Hi-Seq 2000 platform ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Paired-end (2×100) sequencing was performed on a HiSeq (Illumina) by Novogene.
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Physiology 2021Quote: ... High-throughput genome sequencing was performed on a HiSeq 2500 (2 × 100 or 2 × 150 paired-end reads) or MiSeq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... or paired-end (2 × 100 bp) on the Novaseq 6000 platform (Illumina).
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mono-nucleosomal DNAs were subjected to sequencing using a TruSeq DNA library prep kit (FC-121-2001, Illumina). The final libraries were sequenced using an Illumina HiSeq 2500 platform ...
-
bioRxiv - Immunology 2020Quote: ... using NextSeq 500/550 v2.5 sequencing reagent kit (read length: 2 × 75 bp) or NovaSeq S1 sequencing reagent kit (read length: 2 × 100 bp) (Illumina) respectively ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Genomics 2019Quote: Libraries were prepared using NexteraXT and paired-end sequenced on the MiSeq (v3, 2×300 cycles) or iSeq 100 (I1, 2×150 cycles) platforms according to manufacturer instructions (Illumina Inc). All sequences were deposited in the SRA under accession number PRJNA561185.
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in 2 × 100 nt manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Genomics 2020Quote: ... Sequencing was performed using 2×100 bp paired-end mode on HiSeq 4000 (Illumina) in Genomed SA (Warsaw ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing (2 x 100 bp) was carried out with HiSeq 4000 (Illumina), pooling two patients’ samples on one lane ...
-
bioRxiv - Genomics 2019Quote: ... We reverse transcribed 1 ug of total RNA with the partial P7 adapter (Illumina_4N_21T) and dNTPs with the addition of spiked-in azido-nucleotides (AzVTPs ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2020Quote: ... Paired-reads (2×100 bp) were sequenced on the NovaSeq 6000 S2 flowcell (Illumina, Inc.). DNA and RNA library preparation and sequencing were performed at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Biophysics 2023Quote: ... using iSeq 100 i1 reagent v2 kit (300 cycle) 2 x 150 read length (Illumina). The total number of reads were 150,000-400,000 per sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were prepared from 1 ug of RNA following TruSeq Stranded Total RNA kit (Illumina) with two technical replicates for each sample ...
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Pathology 2021Quote: ... using the 2×75bp kit or on the HiSeq 2500 platform (100 base, paired end; Illumina) with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... and subjected to pair-end sequencing (100 cycles: 2×50) on the Novaseq-6000 sequencer (Illumina) at the Genomic platform (Gustave Roussy ...
-
bioRxiv - Genetics 2023Quote: ... Paired-end sequencing (2 × 150 bases) of these amplicons was performed using an iSeq 100 (Illumina).
-
bioRxiv - Microbiology 2023Quote: The prepared libraries were sequenced (2×100 bp paired-end sequencing) on the HiSeq 2500 (Illumina) platform ...
-
bioRxiv - Plant Biology 2023Quote: ... and sequencing of 2 × 100 bp paired-end reads using the NovaSeq 6000 (Illumina, United States). Obtained raw reads were mapped to strain the V35 genome using Kallist 0.43.1 with the default setting (Bray et al ...
-
bioRxiv - Genomics 2023Quote: ... RNA-seq (2 × 100 nt paired-end reads) was performed using a HiSeq 3000 instrument (Illumina), yielding an average of 38 million reads/sample.
-
bioRxiv - Genetics 2024Quote: ... followed by paired-end (2□×□100□bp) sequencing using the Illumina HiSeq 4000 Sequencing System (Illumina) at the Beijing Genomics Institute ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were prepared from 1 ug RNA (TruSeq Stranded Total RNA Library Prep Kit, Illumina) and 100 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA libraries were prepared from 1 ug RNA (TruSeq Stranded Total RNA Library Prep Kit, Illumina) and 100 bp ...