Labshake search
Citations for Illumina :
1 - 50 of 965 citations for MERS Coronavirus Spike Glycoprotein S1 Camel Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... K-mer filtering (which removes reads with a 31-mer match to an Illumina spike-in), and Entropy filtering (>0.90 ...
-
bioRxiv - Cell Biology 2023Quote: ... with a 5% spike-in of PhiX v3 (Illumina FC-110-3001).
-
bioRxiv - Cell Biology 2023Quote: ... with a 5% spike-in of PhiX v3 (Illumina, FC-110-3001).
-
bioRxiv - Plant Biology 2022Quote: ... K-mers from Illumina read data were counted ...
-
bioRxiv - Genomics 2023Quote: ... and combined with 50% PhiX spike-in control (Illumina, Cat# FC-110-3001). Single-end 300mer sequencing was then performed on a MiSeq platform (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... which included a 1% PhiX spike (PhiX Control v3; Illumina Catalogue FC-110-3001). The data was uploaded to BaseSpace (http://www.basespace.illumina.com ...
-
bioRxiv - Genomics 2020Quote: ... Erroneous k-mers from Illumina paired-end reads were removed using rCorrector [91] ...
-
bioRxiv - Genomics 2023Quote: Genome size was estimated by K-mer (17-mer) analysis using reads generated by Illumina Hiseq sequencing according to Lander-waterman theory ...
-
bioRxiv - Genetics 2023Quote: ... A 10% spike-in of PhiX control V3 (#FC-110-3001; Illumina, San Diego, CA) was added to these amplicons ...
-
bioRxiv - Immunology 2022Quote: ... sample tags: 600 reads per cell on Illumina NovaSeq using S1 and S2 100 cycle kits (Illumina) (67×8×50 bp) ...
-
bioRxiv - Genomics 2021Quote: ... K-mer based analysis from Illumina sequencing data derived from the Rothamsted population also indicated a genome size from 3,400 Mb to 3,550 Mb ...
-
bioRxiv - Genomics 2022Quote: We collected 21-mers from Illumina reads of HG002 (250bp paired-end ...
-
bioRxiv - Neuroscience 2022Quote: ... with a 20% v/v PhiX Control v3 spike-in (Illumina, Cat. No. FC-110-3001) and sequenced on Illumina’s NovaSeq 6000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were then tagmented using the Illumina/Nextera DNA prep kit (FC 121-1030) with index tags from Illumina (FC 121-1031), cleaned up with Ampure XP beads ...
-
bioRxiv - Synthetic Biology 2023Quote: The sequencing libraries were mixed with 20–30% of PhiX spike-in DNA control (Illumina #FC-110-3001) for better cluster generation on the flow cell and sequenced by Illumina MiSeq (MiSeq v3 150-cycles kit #MS-102-3001 or 300-cycles kit #MS-102-3003) ...
-
bioRxiv - Genomics 2020Quote: ... so k-mers were collected later from Illumina whole genome sequencing reads instead ...
-
bioRxiv - Genomics 2023Quote: ... a 51-bp k-mer matrix from Illumina paired raw reads of 136 lablab accessions was created using Jellyfish (v ...
-
bioRxiv - Microbiology 2022Quote: ... S1 (Illumina #20012865), or S2 (Illumina #20012862 ...
-
bioRxiv - Genomics 2021Quote: ... First a k-mer profile was generated from Illumina reads using jellyfish 2.3.0 tools (Marçais & Kingsford 2011 ...
-
bioRxiv - Plant Biology 2021Quote: ... a K-mer frequency distribution was generated from Illumina 2×150 bp paired reads (described below ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Genomics 2020Quote: ... and pooled in equal concentrations prior to MiSeq v3 sequencing with 15% phiX control spike-in (Illumina FC-110-3001).
-
bioRxiv - Genomics 2019Quote: ... single-end mode) at 12 pM loading concentration with 10% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: ... single-end mode) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Microbiology 2023Quote: ... All sequencing runs were performed with a spike-in of 1% PhiX control library V3 (Illumina, Cat. FC-110-3001). The sequencing mean library size was 134,629,540.5 reads [range ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Whole genome sequencing data has been deposited in the Sequence Read Archive under PRJNA529870.
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina, cat. no. 20028317; 0.5% of the PhiX control library, Illumina, cat. no. FC-110-3001) and the standard clustering procedure.
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Systems Biology 2023Quote: ChIP-seq and input libraries were sequenced on the Illumina NextSeq 500 system with a ∼20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Genomics 2021Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike (PhiX Control v3 Illumina Catalogue FC-110-3001).
-
bioRxiv - Genomics 2022Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1 % PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Data was uploaded to Basespace (www.basespace.illumina.com ...
-
bioRxiv - Developmental Biology 2019Quote: ... ChIP-seq libraries were sequenced as single-end 75-mers by Illumina NextSeq 500 ...
-
bioRxiv - Genomics 2022Quote: ... The variants were filtered with Merfin using k-mers derived from Illumina short reads ...
-
bioRxiv - Genetics 2019Quote: ... 1% PhyX spike-in (Illumina) was included ...
-
bioRxiv - Systems Biology 2022Quote: ... 1% PhyX spike-in (Illumina) was added then pooled ...
-
bioRxiv - Neuroscience 2020Quote: ... and sequencing using Novaseq-S1 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... adding 10% PhiX spike-in (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... Nextera XT indices were used to generate libraries from 1 ng of cDNA material for each sample following the instructions provided by Illumina (Illumina FC-131-1096 and FC-131-2001). Library preparations were purified using AMPure XP beads and checked for quality using the Agilent Bioanalyzer at Stanford Functional Genomics Facility (SFGF) ...
-
bioRxiv - Genomics 2021Quote: ... and a similar k-mer distribution pattern to GenomeScope2 (performed with Illumina PE reads). Additionally ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and dual-indexed with Nextera XT Index Kit V2 Sets A-D (FC-131-2001, FC-131-2002, FC-131-2003, FC-131-2004, Illumina, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... or NovaSeq 6000 S1 reagent kit (Illumina, 20012863), respectively ...
-
bioRxiv - Genetics 2023Quote: ... using NovaSeq 6000 S1 Reagent Kit (Illumina, 20028318). Sequencing metrics are available in Table S3.
-
bioRxiv - Neuroscience 2021Quote: ... or PhiX bacteriophage (Illumina spike-in control) sequences ...
-
bioRxiv - Cancer Biology 2024Quote: ... including a 10% PhiX spike-in (Illumina) and sequenced on a MiSeq (Illumina ...