Labshake search
Citations for Illumina :
1 - 50 of 1336 citations for L Phenylalanine N T Boc 2 13C 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Immunology 2024Quote: ... RNAseq data of 4 databases covering 66 healthy tissues (Uhlen: n=122 individuals, n=32 tissues65; GTEx: n=1,315 individuals, n=53 tissues66; Illumina body map ...
-
bioRxiv - Systems Biology 2022Quote: ... we sorted 500-1000 clonally expanded HLA-A2/YFV NS4b-specific CD8+ T cells directly into 22.5μl of ATAC-buffer (12.5μl 2× TD Buffer (Illumina), 0.5μl 1% Digitonin (Promega G9441) ...
-
bioRxiv - Genetics 2022Quote: ... the genome FASTA file was augmented with ERCC sequences to create a STAR genome index with 99 bp overhangs (optimized for Illumina 2 × 100 bp paired-end reads). Two-pass mapping was executed ...
-
bioRxiv - Plant Biology 2023Quote: ... The nuclei pellet was then immediately resuspended in 25 μ L of 2x tagmentation buffer containing 2 μ L of TDE1 (Illumina). The reaction was placed at 37C for 30 minutes with gentle mixing three times ...
-
bioRxiv - Cell Biology 2019Quote: ... the libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library and on average a minimum of 30,000 reads per single-cell.
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library.
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... Both low density 15k SNP chip (SheepLD; n=2,956) and medium density 50k SNP chip (Ovine SNP50 BeadChip; n=3,889) were purchased from Illumina Inc ...
-
bioRxiv - Microbiology 2023Quote: Raw data generated from Illumina (n=22) and PacBio (n=2 ...
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10%(v/v) N,N-dimethyl formamide) and 1 μl of Tagment DNA Enzyme from Nextera Sample Preparation Kit (Illumina) were added to the DNA-beads complex and incubated for 70 sec at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... we used one batch of 20 ng of total photoreceptor (n = 8) RNA and 30 ng for the other three batches (n = 24) according to the manufacturer’s protocol (Illumina Platforms). For generating libraries from RPE samples we used 20 ng of RNA ...
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA purified from hippocampi of WT and Atf6b−/− mice (n=2 per group) was used to prepare RNA libraries using a TruSeq Stranded mRNA Sample Preparation Kit (Illumina, Inc., San Diego, CA, USA), with polyA selection for ribosomal RNA depletion ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Each clone (n=22) was sequenced by Illumina with 150pb paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each clone (n=15) was sequenced by Illumina with 150pb paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... a selection of 288 Enterobacterales recovered from water (n=155) and wastewater (n=133) samples underwent paired-end short read sequencing using Illumina (Illumina, USA) NovaSeq 6000 or MiSeq platforms ...
-
bioRxiv - Genomics 2020Quote: ... using 5% PhiX without dark cycles (n = 11) or 10-20% PhiX with 7 dark cycles (protocol provided by Illumina, n = 49). A maximum of 12 samples were pooled in one sequencing run resulting in 19.05 million [17.05 – 21.72] single-end reads per sample on average (supplementary table 3).
-
bioRxiv - Neuroscience 2021Quote: ... We used TruSeq Stranded mRNA kits (Illumina P/N 20020594) to prepare the stranded mRNA libraries ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex, Deduped and Fivepercent methods and 10 for Illumina and 13 for NEB). We normalized the data using the DESeq2(40 ...
-
bioRxiv - Developmental Biology 2022Quote: ... PhiX Control v3 adapter-ligated library (Illumina p/n FC110-3001) was spiked-in at 1% by weight to ensure balanced diversity and to monitor clustering and sequencing performance ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... The TruSeq RNA Sample Preparation Kit (Illumina, Cat. N°RS-122-2002, USA) was used for library preparation (1 µg total RNA) ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=84 genotyped animals retained after quality control of the Illumina reads). Controls were animals which were lesion and culture negative for M ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=128 genotyped animals retained after quality control of the Illumina reads). An additional Fulani animal was also genotyped but we did not have any information on its M ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the two libraries then were pooled with 48 libraries of other projects and subsequently sequenced on 0.09% (L. virgatum) and 0.08% (L. vulgare) of one lane on an Illumina MiSeq system (Illumina, San Diego, California, USA) at the Department of Biochemistry I at the University of Regensburg ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ T cells were sequenced on a HiSeq 2500 or HiSeq 3000 sequencing system (Illumina paired-end multiplexing run ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
bioRxiv - Genomics 2022Quote: Multi-omics data utilized in JHS analyses including methylomics (n = 1,750, Illumina MethylationEPIC BeadChip array) [40] and proteomics (n = 2,144 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
bioRxiv - Immunology 2022Quote: ... and T cell mRNA targeted libraries were pooled together before sequencing on a NovaSeq6000 instrument (Illumina). For sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10% (vol/vol) dimethylformamide) and 2.5 ?l of TDE1 enzyme (Illumina). Transposed fragments were purified using a MinElute PCR purification kit (QIAGEN) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 300pM of the pooled library was loaded onto a NovaSeq S1 flowcell (Illumina p/n 20012865), using the Standard Workflow loading conditions designated by the manufacturer and amplified by exclusion amplification (ExAMP ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Molecular Biology 2023Quote: ... The abundance of the guide RNAs in the T = 0 and T10 replicates was determined by Illumina Next Generation Sequencing ...
-
bioRxiv - Neuroscience 2019Quote: ... Index 2: 8 cycles) across 2 runs on a NextSeq 500 (Illumina) with an average read depth across biological replicates of 8,815 reads per cell.
-
bioRxiv - Genomics 2020Quote: ... 300×2 bp or 150×2 bp (Illumina, Inc., San Diego, CA).