Labshake search
Citations for Illumina :
1 - 50 of 611 citations for L Isoleucine N Fmoc 1 13C 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Immunology 2024Quote: ... RNAseq data of 4 databases covering 66 healthy tissues (Uhlen: n=122 individuals, n=32 tissues65; GTEx: n=1,315 individuals, n=53 tissues66; Illumina body map ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10%(v/v) N,N-dimethyl formamide) and 1 μl of Tagment DNA Enzyme from Nextera Sample Preparation Kit (Illumina) were added to the DNA-beads complex and incubated for 70 sec at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... Both low density 15k SNP chip (SheepLD; n=2,956) and medium density 50k SNP chip (Ovine SNP50 BeadChip; n=3,889) were purchased from Illumina Inc ...
-
bioRxiv - Microbiology 2023Quote: Raw data generated from Illumina (n=22) and PacBio (n=2 ...
-
bioRxiv - Neuroscience 2020Quote: ... we used one batch of 20 ng of total photoreceptor (n = 8) RNA and 30 ng for the other three batches (n = 24) according to the manufacturer’s protocol (Illumina Platforms). For generating libraries from RPE samples we used 20 ng of RNA ...
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Each clone (n=22) was sequenced by Illumina with 150pb paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each clone (n=15) was sequenced by Illumina with 150pb paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... a selection of 288 Enterobacterales recovered from water (n=155) and wastewater (n=133) samples underwent paired-end short read sequencing using Illumina (Illumina, USA) NovaSeq 6000 or MiSeq platforms ...
-
bioRxiv - Genomics 2020Quote: ... using 5% PhiX without dark cycles (n = 11) or 10-20% PhiX with 7 dark cycles (protocol provided by Illumina, n = 49). A maximum of 12 samples were pooled in one sequencing run resulting in 19.05 million [17.05 – 21.72] single-end reads per sample on average (supplementary table 3).
-
bioRxiv - Neuroscience 2021Quote: ... We used TruSeq Stranded mRNA kits (Illumina P/N 20020594) to prepare the stranded mRNA libraries ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex, Deduped and Fivepercent methods and 10 for Illumina and 13 for NEB). We normalized the data using the DESeq2(40 ...
-
bioRxiv - Developmental Biology 2022Quote: ... PhiX Control v3 adapter-ligated library (Illumina p/n FC110-3001) was spiked-in at 1% by weight to ensure balanced diversity and to monitor clustering and sequencing performance ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina ...
-
bioRxiv - Genetics 2020Quote: ... were incubated in a 50 µl reaction with 0.8 µl of Tn5 transposase at 1× TD buffer from the Nextera library preparation kit (Illumina) for 5 min at 55°C ...
-
bioRxiv - Genetics 2022Quote: ... the genome FASTA file was augmented with ERCC sequences to create a STAR genome index with 99 bp overhangs (optimized for Illumina 2 × 100 bp paired-end reads). Two-pass mapping was executed ...
-
bioRxiv - Neuroscience 2020Quote: ... The TruSeq RNA Sample Preparation Kit (Illumina, Cat. N°RS-122-2002, USA) was used for library preparation (1 µg total RNA) ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=84 genotyped animals retained after quality control of the Illumina reads). Controls were animals which were lesion and culture negative for M ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=128 genotyped animals retained after quality control of the Illumina reads). An additional Fulani animal was also genotyped but we did not have any information on its M ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the two libraries then were pooled with 48 libraries of other projects and subsequently sequenced on 0.09% (L. virgatum) and 0.08% (L. vulgare) of one lane on an Illumina MiSeq system (Illumina, San Diego, California, USA) at the Department of Biochemistry I at the University of Regensburg ...
-
bioRxiv - Plant Biology 2023Quote: ... The nuclei pellet was then immediately resuspended in 25 μ L of 2x tagmentation buffer containing 2 μ L of TDE1 (Illumina). The reaction was placed at 37C for 30 minutes with gentle mixing three times ...
-
bioRxiv - Genomics 2022Quote: Multi-omics data utilized in JHS analyses including methylomics (n = 1,750, Illumina MethylationEPIC BeadChip array) [40] and proteomics (n = 2,144 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10% (vol/vol) dimethylformamide) and 2.5 ?l of TDE1 enzyme (Illumina). Transposed fragments were purified using a MinElute PCR purification kit (QIAGEN) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 300pM of the pooled library was loaded onto a NovaSeq S1 flowcell (Illumina p/n 20012865), using the Standard Workflow loading conditions designated by the manufacturer and amplified by exclusion amplification (ExAMP ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Microbiology 2019Quote: ... denatured with 0.1 N NaOH and after dilution loaded in a MiSeq Reagent kit V2-500 (Illumina) at 8 pM concentration ...
-
bioRxiv - Cell Biology 2019Quote: ... the libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library and on average a minimum of 30,000 reads per single-cell.
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 2017 (n = 11) were prepared into two Illumina TruSeq LT libraries (Illumina, Inc. San Diego, CA), and sequenced on two Illumina NextSeq500 runs.
-
bioRxiv - Genomics 2020Quote: ... All other bulls (N = 3679) were genotyped at approximately 50,000 SNPs using medium density (MD) chips (e.g., the Illumina BovineSNP50 bead chip that comprises 54,001 (version 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array data (either Illumina human methylation27K array, n = 15 genomes; or Illumina human methylation450K array ...
-
bioRxiv - Physiology 2020Quote: Sequencing libraries (n=167) were prepared with the TruSeq Stranded mRNA HS kit (Illumina, San Diego, California, USA). The 2100 Bioanalyzer using the DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... The sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) and Qubit 3.0 with dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... 30 libraries (n=15 for each group) were constructed using the HiSeq Library Preparation kit (Illumina, San Diego, USA) and sequenced using Illumina NovaSeq™ ...
-
bioRxiv - Cancer Biology 2022Quote: mRNA libraries of the mouse melanoma tumor (n = 12) samples were prepared and sequenced using the HiSeq 2000 (Illumina). RNAseq data were processed by pyflow-RNAseq (Tang ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Cancer Biology 2023Quote: ... All samples were pooled equimolarly and sequenced on a NextSeq 500 High Output v2.5 flowcell (Illumina p/n 20024906) using the Illumina NextSeq 500 sequencing instrument with a single-read configuration (75 bp) ...
-
bioRxiv - Zoology 2023Quote: ... construction using the ONT rapid barcoding kit (SQK-RBK004 or SQK-RBK110.96) or an Illumina MiSeq (n=257) using the Nextera XT Library Preparation kit (Illumina) following the manufacturers’ protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... The barcode sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824). Sequencing libraries were loaded at 18 pM on an Illumina HiSeq2500 using the following read length ...
-
bioRxiv - Cancer Biology 2020Quote: The RNA-seq libraries (n=3 per experimental group) were prepared using the NEBNext Ultra II RNA library prep kit from Illumina (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...