Labshake search
Citations for Illumina :
1 - 50 of 2018 citations for Indeno 1 2 3 Cd Pyrene D12 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... (28+98) (Illumina). For the Tbx1LacZ/+Crkl+/- dataset ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing was performed on an Illumina NovaSeq platform (paired-end, Read 1: 26 cycles and Read 2: 98 cycles) according to the manufacturer’s instructions (Illumina).
-
bioRxiv - Genomics 2020Quote: ... and 2.5μL (20μM) each of 2 indexed primers (Illumina TruSeq Combinatorial Dual (CD) index adapters ...
-
bioRxiv - Microbiology 2024Quote: ... Nextera DNA CD Indexes (Illumina) were used ...
-
bioRxiv - Genomics 2022Quote: ... and Nextera DNA CD Indexes (Illumina) for 10 cycles of PCR ...
-
bioRxiv - Microbiology 2023Quote: ... Nextera DNA CD Indexes (Illumina, Inc.) were used for indexing during library prep ...
-
bioRxiv - Developmental Biology 2022Quote: ... with Nextera DNA CD Indexes (Illumina #20015882), according to the following program ...
-
bioRxiv - Developmental Biology 2023Quote: ... and TruSeq RNA CD Index Plate (Illumina, USA) for sample multiplexing ...
-
bioRxiv - Microbiology 2023Quote: ... using Nextera DNA CD indexes (Illumina Catalog No. 20018708). DNA yield was measured with a Qubit High Sensitivity dsDNA assay kit (ThermoFisher Catalog No ...
-
bioRxiv - Microbiology 2023Quote: ... along with the Nextera DNA CD Indexes (Illumina, 20018707). Nanopore sequencing was performed with the Oxford Nanopore MinION and MinKNOW software ...
-
bioRxiv - Neuroscience 2023Quote: ... libraries were barcoded with AmpliSeq CD Indexes (Illumina, 20031676) and pooled with similar molecular numbers based on measurements made with a Qubit dsDNA High Sensitivity kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... adding indexes from a Nextera CD Indexes Kit (Illumina, USA). Shotgun sequencing was performed on a NextSeq 550 instrument (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... Tagmented DNA was amplified using Nextera DNA CD Indexes (Illumina). Samples were placed overnight at 4 °C following the tagmented DNA amplification step ...
-
bioRxiv - Neuroscience 2021Quote: ... the purified DNA was mixed with CD index primers (Illumina) and Phusion High Fidelity PCR MasterMix (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... and utilizing the Nextera DNA CD Index Kit (Illumina, 20018708) following the manufacturer recommended protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and Nextera™ DNA CD Indexes (catalog number 20018707, Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Individual libraries were barcoded with Nextera DNA CD Indexes (Illumina) and analyzed for average size distribution and concentration on a High Sensitivity DNA Bioanalyzer chip from Agilent Technologies ...
-
bioRxiv - Genomics 2023Quote: ... using Nextera DNA CD Indexes (Reference Guide 1000000025416.v07, Illumina). Quality and fragment size of all libraries were assessed by capillary electrophoresis on a TapeStation 4200 ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were generated using Illumina Nextera CD Indexes (Illumina #20018708) and sequenced in paired-end mode (2×75bp ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Genomics 2020Quote: ... We used the Nextera DNA CD indexes (Illumina, San Diego, USA). We cleaned the libraries using 0.9x sample purification beads and eluted in 32μl resuspension buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Microbiology 2019Quote: ... 2x 8 nt dual indexed adapters from TruSeq RNA CD index kit (Illumina) were added to the libraries for multiplexing ...
-
bioRxiv - Molecular Biology 2021Quote: ... as recommended by the manufacturer using the Illumina CD RNA indexes (Illumina, USA). Libraries were quantified and qualified using a qPCR quantification protocol guide (KAPA Library Quantification Kits for Illumina Sequencing platforms ...
-
bioRxiv - Cell Biology 2022Quote: ... and Nextera™ DNA CD Indexes (24 Indexes, 24 Samples) (ref #20018707, Illumina) according to the manufacturer’s protocol (Nextera DNA Flex Library Document ...
-
bioRxiv - Genomics 2023Quote: ... lapponica using a Nextera DNA Flex kit with Nextera DNA CD indexes (Illumina). Each library was constructed with 500ng of starting material ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... The purified DNA was amplified and indexed using Nextra DNA CD Indexes (Illumina, 20018707), and size distribution of the DNA libraries was analysed using High-sensitivity Qubit dsDNA Assay Kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were pooled and sequenced paired end (R1:26, R2:98 cycles) on a NextSeq 550 (Illumina) at 200 million reads per library.
-
bioRxiv - Developmental Biology 2019Quote: ... and 98 bases (v2) or 91 bases (v3) for Read2 on the Novaseq 6000 Sequencing System (Illumina) to over 80% saturation level.
-
bioRxiv - Genomics 2021Quote: ... Samples were amplified for 12 cycles of PCR with TruSeq RNA CD Index Plate (Illumina) and pooled ...
-
bioRxiv - Microbiology 2022Quote: Libraries were built using the Illumina DNA Prep protocol and Nextera DNA CD indexes (Illumina). Libraries were sequenced at the Perinatology Research Branch using iSeq 100 reagents (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... IDT for Illumina DNA/RNA UD indexes and Nextera DNA CD indexes were used (Illumina IDT ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2020Quote: ... The A-overhanged products were ligated with index adapters for Illumina sequencing (TruSeq DNA CD Indexes, Illumina). Post-ligation products were cleaned up using AMPure beads (bead:library at 0.8:1 ratio ...
-
bioRxiv - Molecular Biology 2021Quote: ... was used according to manufacturer’s protocol to ligate TruSeq (CD, formerly TruSeq HT) dual index adapters (Illumina Adapter Sequences ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... for 4000 cells was performed according to manufacturer’s instructions and the libraries were paired-end sequenced (R1:27, i7-index:8, R2:98) on HiSeq 4000 (Illumina). Preprocessing of scRNA-seq data ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were barcoded on both ends using Nextera DNA CD Indexes (Illumina Inc., San Diego, California, USA). The thermal cycler protocol consisted of a denaturation step of 3 minutes at 95°C ...
-
bioRxiv - Microbiology 2021Quote: IDT for Illumina TruSeq DNA UD Indexes 20022370 or TruSeq DNA CD Indexes 20015949 (Integrated DNA Technologies, Illumina) were used in place of NEBNext adaptors ...
-
bioRxiv - Cancer Biology 2023Quote: ... pooled using appropriate Illumina Truseq CD i5/i7 index adapters and sequenced on a Novaseq-6000 instrument (Illumina) to the depth of ∼20x for LSK and ∼4x for CMP and GMP samples.
-
bioRxiv - Microbiology 2023Quote: ... by the manufacturer’s protocol (DNA input ≥100 ng) but using TruSeq DNA PCR-free CD index 20015949 (Illumina) adapters to eliminate PCR amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were prepared using the Illumina DNA Prep Tagmentation Kit and barcoded using the Nextera DNA CD Indexes (Illumina). 150 bp paired-end sequencing was performed on an Illumina iSeq 100.
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...