Labshake search
Citations for Illumina :
1 - 50 of 403 citations for IL 5 Rat CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... and rat (Illumina). RNAs longer than 200 nt were selectively recovered using the RNA Clean & Concentrator-5 kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...
-
bioRxiv - Genomics 2019Quote: ... mouse and rat (Illumina, USA). Sequencing has been done with 2×250 bp paired-end on a HiSeq 2500 (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Ribo-Zero rRNA Removal Kit (Illumina human/mouse/rat) was applied to remove the rRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina Ribo Zero Gold for human/mouse/rat kit (Illumina) was used to remove rRNA during sample preparation per manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) was used.
-
bioRxiv - Genomics 2019Quote: ... with Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). The cDNA libraries from human and mouse samples were sequenced on the Illumina HiSeq 2500 and Illumina NextSeq 500 platforms ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by sequencing with an Illumina HiSeq 2500 (Illumina, San Diego, IL, USA) to construct a library.
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Genomics 2020Quote: ... Illumina TruSeq Stranded Total RNA Ribo-Zero Human/Mouse/Rat Gold (Illumina) was used to construct ribosomal RNA depleted sequencing libraries ...
-
bioRxiv - Neuroscience 2022Quote: ... reads were mapped to the Rnor 6.0 rat genome obtained from Illumina iGenomes (Ensembl ...
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and rRNA-depletion (“Ribo-Zero”; Illumina Ribo-Zero Gold Kit (Human/Mouse/Rat), Cat # MRZG126 ...
-
bioRxiv - Genetics 2020Quote: ... or the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... ribosomal RNA was removed using the Ribo-Zero Human/Mouse/Rat kit (Illumina). Sequencing libraries were generated according to the TruSeq stranded total RNA (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... Ribosomal RNA was removed by Illumina Ribo-Zero Gold rRNA Removal Kit Human/Mouse/Rat (Illumina, San Diego, CA, USA) and stranded total RNA-seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation v2 Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... All RNA samples were treated with RiboZero (Human/Mouse/Rat) (Illumina, San Diego, CA) for the depletion of ribosomal RNA ...
-
bioRxiv - Genetics 2020Quote: RNA-seq libraries (TruSeq® Stranded Total RNA Library Prep Human/Mouse/Rat, Illumina) were prepared from 150 ng of previously isolated viral RNA according to the manufacturers’ protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA-depleted by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina), and reverse transcribed by ProtoScript II Reverse Transcriptase (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... The Ribo-Zero Gold (Human/Mouse/Rat) and (Yeast) kit (Illumina, San Diego, CA) were used to deplete rRNA using 300 ng total RNA as input ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Immunology 2021Quote: ... and sequencing libraries generated with a TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina). Libraries were sequenced on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Plant Biology 2023Quote: ... Library preparation included the “TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat”-kit (Illumina), ribosomal RNA depletion and a size selection step for 300 bp fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNAs were depleted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2024Quote: ... stand-alone Ribo-Zero kits [Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat)] (Illumina), Ribo-Zero accompanied by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ribosomal RNA was depleted using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and the RNA-seq library was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Zoology 2021Quote: ... the ribosomal RNA was removed using the Ribo-Zero-Gold (Human–Mouse–Rat) Kit (Illumina, USA) and the Ribo-Zero-Gold (Epidemiology ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) including a ribosomal RNA depletion step and sequenced on the Illumina HiSeq2500 platform (50 nt single-end reads).
-
bioRxiv - Microbiology 2022Quote: ... after first removing the host rRNA with a Ribo-Zero-Gold (Human–Mouse–Rat) kit (Illumina). Each library was sequenced as 100-bp paired-ends on the Novaseq 6000 S4 platform (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained RNA was depleted of rRNAs with Ribo-Zero Gold Kit (Human/Mouse/Rat) kit (Illumina), separated in 17% Urea gel and stained with SYBR Gold (Invitrogen) ...
-
bioRxiv - Pathology 2021Quote: ... Ribosomal RNA depletion was carried out solely using the RiboZero Gold Human/Mouse/Rat kit (Illumina). Adapter sequences were based on the TruSeq small RNA sequences (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... For mouse and rat sequencing data the reference genome GRCm38 and Rnor 6.0 provided by Illumina igenomes were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was performed with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Molecular Biology 2021Quote: ... ribosomal RNAs were removed by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224). Then ...