Labshake search
Citations for Illumina :
1 - 50 of 525 citations for IL 5 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by sequencing with an Illumina HiSeq 2500 (Illumina, San Diego, IL, USA) to construct a library.
-
bioRxiv - Genomics 2021Quote: ... four human CNV membranes and four human RPE-choroidal control tissues) were sequenced on the NextSeq 500 (Illumina) with 1 × 75 bp ...
-
bioRxiv - Genomics 2021Quote: BD Infinium Human Methylation 450 arrays (Illumina) were retrieved from the European Genome-phenome Archive (EGA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was done with Illumina NextSeq 500 using NextSeq 500/550 High Output Kit v2.5 for HeLa samples and with Illumina NovaSeq 6000 using partial S4 flow cell lane for patient samples.
-
bioRxiv - Neuroscience 2022Quote: ... A Human OmniExpress v1.2 BeadChip array (Illumina) was used post-editing to check for any gross karyotype abnormalities ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: The Illumina Infinium Human Methylation 450k BeadChip (Illumina 450K array) prostate adenocarcinoma dataset was downloaded from the TCGA consortium database ...
-
bioRxiv - Genetics 2019Quote: ... and genotyped on the Infinium Human CoreExome-24 BeadChip (Illumina). Variants missing >5% of total genotypes and variants that deviated from Hardy-Weinberg equilibrium were removed ...
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The Illumina Infinium® human 450k (Illumina, WG-314-10031) and EPIC methylation (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... IM and YA using the Sentrix Human CNV370 BeadChip (Illumina) and analysed using GenomeStudio software.
-
bioRxiv - Molecular Biology 2022Quote: ... The Ribo-Zero rRNA Removal Kit (Illumina human/mouse/rat) was applied to remove the rRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina Ribo Zero Gold for human/mouse/rat kit (Illumina) was used to remove rRNA during sample preparation per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) was used.
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array (Illumina human methylation450K array) data were downloaded from the ICGC data Portal (https://dcc.icgc.org/ ...
-
bioRxiv - Molecular Biology 2020Quote: ... Methylation was analysed using the Infinium Human Methylation EPIC array (Illumina) using standard operating procedures at the UCL Genomics facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... Probe locations on the human genome (hg19 version) defined by Illumina was used for the analysis ...
-
bioRxiv - Genomics 2019Quote: ... with Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). The cDNA libraries from human and mouse samples were sequenced on the Illumina HiSeq 2500 and Illumina NextSeq 500 platforms ...
-
bioRxiv - Cancer Biology 2020Quote: Human RNA sequencing data and DNA sequencing data (Illumina HiSeq RNASeqV2) from the Colorectal Adenocarcinoma dataset from The Cancer Genome Atlas (Nature 2012 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (2022) sequenced 2,504 human genomes to 30x coverage (Illumina NovaSeq 6000). They mapped these data to the human genome assembly GRCh38 and called genotypes using GATK HaplotypeCaller ...
-
bioRxiv - Cancer Biology 2023Quote: Human RNA sequencing data and DNA sequencing data (Illumina HiSeq RNASeqV2) from the Colorectal Adenocarcinoma dataset from the TCGA Nature 2012 and TCGA PanCancer Atlas from The Cancer Genome Atlas were downloaded from cBioPortal for Cancer Genomics (https://www.cbioportal.org/).57–59 Data was log2 transformed and analyzed using the DESeq2 package in R (v3.0).60
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Cancer Biology 2021Quote: ... these analyses were performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Neuroscience 2020Quote: ... The Illumina Human CytoSNP-12v2.1 BeadChip array and KaryoStudio analysis software (Illumina) were used to assess genome integrity (Supplementary Table 1).
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Genomics 2022Quote: ... we benchmarked 23 different human genotyping arrays including 14 arrays from Illumina and 9 arrays from Affymetrix ...
-
bioRxiv - Genomics 2020Quote: ... Illumina TruSeq Stranded Total RNA Ribo-Zero Human/Mouse/Rat Gold (Illumina) was used to construct ribosomal RNA depleted sequencing libraries ...
-
bioRxiv - Molecular Biology 2019Quote: ... Trimmed reads were mapped to the human genome (hg38 downloaded from Illumina iGenomes on August 8th ...