Labshake search
Citations for Illumina :
1 - 50 of 9147 citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... ATAC used components from the Nextera DNA Library Preparation Kit (Illumina) as described previously (Buenrostro et al ...
-
bioRxiv - Systems Biology 2019Quote: ... converted to the reverse-complement stranded Illumina sequencing library using the ScriptSeq Complete Kit (Bacteria, Illumina) and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre ...
-
bioRxiv - Developmental Biology 2023Quote: Ribosomal RNAs were depleted from 1 µg of total RNA using TruSeq Stranded Total RNA kit Ribo-Zero components (Illumina) according to the manufacturer’ s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was done with Illumina NextSeq 500 using NextSeq 500/550 High Output Kit v2.5 for HeLa samples and with Illumina NovaSeq 6000 using partial S4 flow cell lane for patient samples.
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2019Quote: A principal components analysis (PCA) on genome-wide genotyped SNPs (Illumina Infinium Omni2.5) was conducted to model continuous axes of genetic variation within the GRaD sample using EIGENSTRAT and is a common method used to correct for differences in genetic substructure across ethnic groups (Cook & Morris ...
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Ribo-Zero rRNA Removal Kit (Illumina human/mouse/rat) was applied to remove the rRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina Ribo Zero Gold for human/mouse/rat kit (Illumina) was used to remove rRNA during sample preparation per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... stand-alone Ribo-Zero kits [Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat)] (Illumina), Ribo-Zero accompanied by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Genomics 2024Quote: ... we first extracted the SVs at chromosome level merged and normalized multi-sample VCF files with MAF >= 0.05 using bcftools (v1.15.1) and then used principal component analysis module of AKT (v0.3.3) (https://github.com/Illumina/akt) on the extracted variants using the following command.
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of input RNA was used for rRNA removal with Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Libraries were generated with the NEBNext Ultra Directional RNA Library Prep kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were prepared from 1 μg of total RNA using a TruSeq Stranded Total RNA Kit with Ribo-Zero Human/Mouse/Rat (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Sequencing was performed by the Human & Environmental Genomics core facility of Rennes on a HiSeq 1500 (Rapid SBS kit v2 1×100 cycles, Illumina). Base Calling was performed with Illumina’s CASAVA pipeline (Version 1.8).
-
bioRxiv - Developmental Biology 2020Quote: ... the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) was used.
-
bioRxiv - Genomics 2019Quote: ... with Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). The cDNA libraries from human and mouse samples were sequenced on the Illumina HiSeq 2500 and Illumina NextSeq 500 platforms ...
-
bioRxiv - Genomics 2021Quote: ... As it is not recommended to use the tandem complement barcodes on the Novaseq platform (Illumina tech support, pers. comm.), only 9,120 of the 9,216 possible barcode combinations can be used out of the barcode v0 design barcodes.
-
bioRxiv - Genomics 2019Quote: Uniquely mapped reads were isolated from BAM files using samtools67 (v1.6) ‘view’ (–q 60 for ONT or –q 255 for Illumina). BAM alignments were converted to BED12 files using BEDtools68 (v2.25.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained RNA was depleted of rRNAs with Ribo-Zero Gold Kit (Human/Mouse/Rat) kit (Illumina), separated in 17% Urea gel and stained with SYBR Gold (Invitrogen) ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: Image analyses and base calling were performed using the NovaSeq Control Software and Real-Time Analysis component (Illumina). Demultiplexing was performed using Illumina’s conversion software (bcl2fastq 2.20) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reads were trimmed to remove adapter sequences and low-quality regions (Q < 30 and Q < 20 for Illumina and 454 data, respectively) were removed using Cutadapt 1.4.1 (Martin 2011 ...
-
bioRxiv - Molecular Biology 2021Quote: RPF were depleted of ribosomal RNA with the Ribo-zero Human kit (Illumina) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2019Quote: ... and rRNA-depletion (“Ribo-Zero”; Illumina Ribo-Zero Gold Kit (Human/Mouse/Rat), Cat # MRZG126 ...
-
bioRxiv - Genetics 2020Quote: ... or the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... ribosomal RNA was removed using the Ribo-Zero Human/Mouse/Rat kit (Illumina). Sequencing libraries were generated according to the TruSeq stranded total RNA (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: Image analyses and base calling were performed using the NovaSeq Control Software and the Real-Time Analysis component (Illumina). Demultiplexing was performed using the 10X Genomics software Cellranger mkfastq (v3.1.0 for experiment 1 and v6.0.1 for experiment 2) ...
-
bioRxiv - Genomics 2021Quote: ... sex and 20 genetic principal components (derived from multidimensional scaling of genotype data from the Illumina 610-Quadv1 array).
-
bioRxiv - Molecular Biology 2019Quote: ... The samples were then transferred on to the ice and the components (15 μl Blunt ligase master mix, 2.5 μl NEB Next adaptor for Illumina, and 1 μl ligation enhancer to a total volume of 83.5 μl ...
-
bioRxiv - Physiology 2023Quote: Image analyses and base calling were performed using NovaSeq Control Software and the Real-Time Analysis component (Illumina, USA). Demultiplexing was performed using Illumina’s conversion software (bcl2fastq 2.20) ...
-
bioRxiv - Genomics 2023Quote: ... Image analyses and base calling were performed using the Miniseq Control Software and the Real-Time Analysis component (Illumina). Demultiplexing was performed using Illumina’s conversion software (bcl2fastq 2.20.0.422) ...
-
bioRxiv - Genomics 2023Quote: ... using the single read 100 nt protocol on 1 lane of a flow cell SP.Image analyses and base calling were performed using the Miniseq Control Software and the Real-Time Analysis component (Illumina). Demultiplexing was performed using Illumina’s conversion software (bcl2fastq 2.20.0.422) ...
-
bioRxiv - Cell Biology 2020Quote: ... then rRNA-depleted using Ribo-Zero rRNA Removal kit for human samples (Illumina MRZH11124) before proceeding with library preparation (TruSeq mRNA Stranded Library preparation kit ...
-
bioRxiv - Cell Biology 2022Quote: ... Ribosomal RNA was removed by Illumina Ribo-Zero Gold rRNA Removal Kit Human/Mouse/Rat (Illumina, San Diego, CA, USA) and stranded total RNA-seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation v2 Kit (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA-depleted by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina), and reverse transcribed by ProtoScript II Reverse Transcriptase (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... The Ribo-Zero Gold (Human/Mouse/Rat) and (Yeast) kit (Illumina, San Diego, CA) were used to deplete rRNA using 300 ng total RNA as input ...
-
bioRxiv - Genomics 2021Quote: ART (ART-MountRainier-2016-06-05, art_Illumina Q Version 2.5.8) (Huang et al ...
-
bioRxiv - Cell Biology 2022Quote: ... libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Kit (cat. RS-122-2201/2202, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... rRNA was removed using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) and Ribo-Zero rRNA Removal Kit (Bacteria) (Illumina). In order to reduce the impact of the host transcriptome on subsequent analysis ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Kit (REF. RS-122-2201/2202, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted with a Direct-zol RNA MicroPrep Kit and subjected to RNA-Seq library preparation using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) followed by a TruSeq Stranded Total RNA Kit (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Immunology 2021Quote: ... and sequencing libraries generated with a TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina). Libraries were sequenced on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Biophysics 2021Quote: ... libraries were constructed using Ribo-Zero Magnetic Gold Kit (Human) (Illumina, San Diego, CA, USA) and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs ...