Labshake search
Citations for Illumina :
1 - 50 of 8801 citations for Human Complement C3 Convertase C3c CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... castellanii strain C3 RNA-seq libraries were prepared using the stranded mRNA Truseq kit from Illumina and sequenced in single-end mode at 150 bp on an Illumina NextSeq machine.
-
bioRxiv - Systems Biology 2019Quote: ... converted to the reverse-complement stranded Illumina sequencing library using the ScriptSeq Complete Kit (Bacteria, Illumina) and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was done with Illumina NextSeq 500 using NextSeq 500/550 High Output Kit v2.5 for HeLa samples and with Illumina NovaSeq 6000 using partial S4 flow cell lane for patient samples.
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2019Quote: ... the Ribo-Zero rRNA Removal kit (Human/Mouse/Rat, Illumina) was employed to deplete ribosomal RNA from 20 µg of total human or mouse brain RNA according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Ribo-Zero rRNA Removal Kit (Illumina human/mouse/rat) was applied to remove the rRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina Ribo Zero Gold for human/mouse/rat kit (Illumina) was used to remove rRNA during sample preparation per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... stand-alone Ribo-Zero kits [Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat)] (Illumina), Ribo-Zero accompanied by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) was used.
-
bioRxiv - Genomics 2019Quote: ... with Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). The cDNA libraries from human and mouse samples were sequenced on the Illumina HiSeq 2500 and Illumina NextSeq 500 platforms ...
-
bioRxiv - Genomics 2021Quote: ... As it is not recommended to use the tandem complement barcodes on the Novaseq platform (Illumina tech support, pers. comm.), only 9,120 of the 9,216 possible barcode combinations can be used out of the barcode v0 design barcodes.
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained RNA was depleted of rRNAs with Ribo-Zero Gold Kit (Human/Mouse/Rat) kit (Illumina), separated in 17% Urea gel and stained with SYBR Gold (Invitrogen) ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: RPF were depleted of ribosomal RNA with the Ribo-zero Human kit (Illumina) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2019Quote: ... and rRNA-depletion (“Ribo-Zero”; Illumina Ribo-Zero Gold Kit (Human/Mouse/Rat), Cat # MRZG126 ...
-
bioRxiv - Genetics 2020Quote: ... or the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... ribosomal RNA was removed using the Ribo-Zero Human/Mouse/Rat kit (Illumina). Sequencing libraries were generated according to the TruSeq stranded total RNA (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... then rRNA-depleted using Ribo-Zero rRNA Removal kit for human samples (Illumina MRZH11124) before proceeding with library preparation (TruSeq mRNA Stranded Library preparation kit ...
-
bioRxiv - Cell Biology 2022Quote: ... Ribosomal RNA was removed by Illumina Ribo-Zero Gold rRNA Removal Kit Human/Mouse/Rat (Illumina, San Diego, CA, USA) and stranded total RNA-seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation v2 Kit (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA-depleted by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina), and reverse transcribed by ProtoScript II Reverse Transcriptase (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... The Ribo-Zero Gold (Human/Mouse/Rat) and (Yeast) kit (Illumina, San Diego, CA) were used to deplete rRNA using 300 ng total RNA as input ...
-
bioRxiv - Cell Biology 2022Quote: ... libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Kit (cat. RS-122-2201/2202, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... rRNA was removed using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) and Ribo-Zero rRNA Removal Kit (Bacteria) (Illumina). In order to reduce the impact of the host transcriptome on subsequent analysis ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Kit (REF. RS-122-2201/2202, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted with a Direct-zol RNA MicroPrep Kit and subjected to RNA-Seq library preparation using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) followed by a TruSeq Stranded Total RNA Kit (Illumina).
-
bioRxiv - Immunology 2021Quote: ... and sequencing libraries generated with a TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina). Libraries were sequenced on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Biophysics 2021Quote: ... libraries were constructed using Ribo-Zero Magnetic Gold Kit (Human) (Illumina, San Diego, CA, USA) and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Plant Biology 2023Quote: ... Library preparation included the “TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat”-kit (Illumina), ribosomal RNA depletion and a size selection step for 300 bp fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNAs were depleted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The bisulfite-converted DNA samples were then processed for hybridization and staining using either the Illumina Infinium Human Methylation 450 BeadChip Kit or the Illumina Infinium MethylationEPIC BeadChip Kit (Illumina Inc.) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal depleted RNA-seq libraries were prepared using the TruSeq® Stranded Total RNA Library Prep Kit Human/Mouse/Rat kit (Illumina, 20020596) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ribosomal RNA was depleted using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and the RNA-seq library was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Zoology 2021Quote: ... the ribosomal RNA was removed using the Ribo-Zero-Gold (Human–Mouse–Rat) Kit (Illumina, USA) and the Ribo-Zero-Gold (Epidemiology ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) including a ribosomal RNA depletion step and sequenced on the Illumina HiSeq2500 platform (50 nt single-end reads).
-
bioRxiv - Microbiology 2022Quote: ... after first removing the host rRNA with a Ribo-Zero-Gold (Human–Mouse–Rat) kit (Illumina). Each library was sequenced as 100-bp paired-ends on the Novaseq 6000 S4 platform (Illumina).
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... we used the Agilent SureSelect Human All Exon kits for library preparation and HiSeq2000 instruments (Illumina) for sequencing ...
-
bioRxiv - Pathology 2021Quote: ... Ribosomal RNA depletion was carried out solely using the RiboZero Gold Human/Mouse/Rat kit (Illumina). Adapter sequences were based on the TruSeq small RNA sequences (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was performed with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation was analysed on 850000 CpGs with the Infinium Human MethylationEPIC Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Genomics 2024Quote: Human islet RNA-seq libraries were prepared from total RNA using the stranded TruSeq kit (Illumina). ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... ribosomal RNAs were removed by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224). Then ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA was depleted from ribosomal RNA using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat, Illumina) followed by cDNA library preparation as described below.
-
bioRxiv - Neuroscience 2022Quote: ... All samples were depleted of ribosomal RNA using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina) (replicates 1-3 and cycloheximide treated ...