Labshake search
Citations for Illumina :
1 - 50 of 9935 citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... CUT&Tag assay was performed using NovoNGS CUT&Tag 3.0 High-Sensitivity Kit (for Illumina, Novoprotein scientific Inc. ...
-
bioRxiv - Cell Biology 2020Quote: QC and quantification of libraries were done by Bioanalyzer (High-Sensitivity DNA Bioanalyzer kit) and mi-seq (Illumina). Sequencing was carried out at the New York Genome Center (NYGC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2) Detection from Illumina RNA-seq data through SL leader sequence trimming(43) ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were quantified sing Qubit High-Sensitivity DNA kit and preparation kit and libraries were constructed using Nextera XT DNA tagmentation (Illumina FC-131-1096) using 800 pg of pooled cDNA library as input using index primers with format as in Gierahn et al [46] ...
-
bioRxiv - Genomics 2021Quote: ... The integrity of the DNA was assessed by capillary electrophoresis using the High Sensitivity Genomic DNA Analysis kit on the Fragment Analyzer (Illumina). Short insert (300 bp ...
-
bioRxiv - Microbiology 2020Quote: ... The quality of the DNA sample was checked by running the Agilent High Sensitivity DNA Kit using an Agilent 2100 Bioanalyzer before sequencing using HiSeq 2500 (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... High Sensitivity D1000 tape and then sequenced on a NextSeq 500 sequencer (Illumina) using a 75-cycle High Output kit using a custom read1 primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC) ...
-
bioRxiv - Immunology 2022Quote: ... with the NextSeq 500/550 High Output 2×75 cycles kit (Illumina). All sequenced samples were quality assessed by capillary electrophoresis with the Agilent RNA 2100 Nano kit (Bioanalyzer ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 plates of mRNA libraries were sequenced using the Nextseq550 high output kit (Illumina) with 35 paired-end reads according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Two Nextseq runs were performed to compile enough reads (19-32 million pass-filter reads).
-
bioRxiv - Cancer Biology 2021Quote: ... Final libraries were quantified on a high-sensitivity bioanalyzer chip and sequenced on the HiSeq (Illumina). Bulk RNA-Seq files are pre-processed for quality control using fastp with default parameters ...
-
bioRxiv - Microbiology 2021Quote: ... 100x coverage using a high-output paired end 2 x 150 sequencing regent kit (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... using using 2 NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005) loaded at 2.5pM and including 1% PhiX ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced with a Nextseq 2×150 pb paired-end reagent kit (NextSeq 500/550 High Output Kit v2.5, Illumina) on an Illumina Nextseq500 sequencer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Final libraries were quantified on a high-sensitivity bioanalyzer chip and sequenced on the NextSeq 550 (Illumina).
-
bioRxiv - Genomics 2019Quote: ... used GATK HaplotypeCaller50 (version 3.5, code at https://hub.docker.com/r/broadinstitute/gatk3) with high-sensitivity settings from Illumina HiSeq 300x 2×150 bp data for the AJ trio ...
-
bioRxiv - Genomics 2019Quote: ... generated independently for each individual in the trio, used freebayes51 (version 0.9.20, code at https://github.com/ekg/freebayes) with high-sensitivity settings from Illumina HiSeq 300x 2×150bp data for the AJ trio ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 150-cycle High Output reagent kit (NextSeq500/550 version 2, FC-404-2002; Illumina) as follows ...
-
bioRxiv - Genomics 2019Quote: ... used the Spiral Genetics Anchored Assembly variant caller (version May 2015, from https://www.spiralgenetics.com/) with high-sensitivity settings from Illumina HiSeq 50x (downsampled by run ...
-
bioRxiv - Immunology 2020Quote: ... using 2×75bp paired-end reads with a High Output 150 cycle kit (Illumina, FC-404-2002).
-
bioRxiv - Cancer Biology 2021Quote: ... with the High Output Kit (Illumina), and a minimum of 35 million read-pairs was generated for each sample.
-
bioRxiv - Cell Biology 2023Quote: ... with High Output NextSeq kit (Illumina) using 2x 75bp paired-end reads.
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were quality controlled with Agilent Bioanalyzer High Sensitivity dsDNA chips and sequenced on a NovaSeq 6000 System (Illumina) at a sequencing depth of a minimum of 60,000 reads per Visium spot ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was quantified using the High Sensitivity DNA Assay on the Agilent 2100 Bioanalyser and paired end Nextera XT (Illumina) libraries were made and sequenced ...
-
bioRxiv - Genomics 2022Quote: ... The fragment size of every library was analysed using the Bioanalyzer high-sensitivity chip and were sequenced on NextSeq500 instruments (Illumina) with the following sequencing parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... as paired-end 2 × 75 base pair read using the NextSeq version 2.5 mid or high-output 150 cycle kit (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... with NextSeq75 High Output v2 kit (Illumina) and paired end 2x 38 bp reads were generated ...
-
bioRxiv - Plant Biology 2019Quote: ... using a MiniSeq High Output kit (Illumina). Total sequencing yielded 12.4 Gbp and generated between 0.73 Gbp and 1.49 Gbp per sample ...
-
bioRxiv - Genomics 2021Quote: ... with a NextSeq High Output kit (Illumina) platform with 2 x 150 read length.
-
bioRxiv - Microbiology 2019Quote: ... The indexed libraries were pooled and diluted to 1.5pM for paired end sequencing (2× 81 cycles) on a NextSeq 500 instrument using the v2 150 cycle High Output kit (Illumina) as per manufacturer’s instructions (generating 80bp paired-ends) ...
-
bioRxiv - Genomics 2021Quote: ... Paired-end sequencing was completed using NextSeq 500/550 300-cycle High-Output Kits v 2.5 (Illumina; 2 × 150 cycles). High-Output kit used for the generation of the NextSeq data allows for over 25 times more sequence data to be generated compared to MiSeq v2 sequencing (800M versus 30M paired reads ...
-
bioRxiv - Genomics 2020Quote: PDT and ATAC libraries were pooled and paired-end sequenced (2 x 34 cycles) using Nextseq High Output Cartridge kits on a Nextseq 550 machine (Illumina). Raw sequencing data were demultiplexed with CellRanger-ATAC mkfastq ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 cycles per index and 120 cycles for read 2 on a NextSeq 500/550 High Output Kit v2.5 (Illumina, 20024907).
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
bioRxiv - Immunology 2020Quote: ... The indexed libraries were pooled and diluted to 1.5pM for paired end sequencing (2× 76 cycles) on a NextSeq 500 instrument using the v2 150 cycle High Output kit (Illumina) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were pooled and sequenced on an Illumina NextSeq instrument using 2×75 paired end reads on a NextSeq high output kit (Illumina). Reads were mapped to the Mus musculus mm10 reference genome using STAR ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were pooled and sequenced in an Illumina NextSeq500 instrument using 2 × 75 paired end reads on a NextSeq high-output kit (Illumina). After de-multiplexing the raw reads to single-cell datasets ...
-
bioRxiv - Microbiology 2022Quote: ... RNA libraries were sequenced using an Illumina NextSeq 550 with the High Output Kit v2.5 -150 Cycles (2 × 75 bp paired-end) (Illumina Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... Sequencing was done using 2 lanes of NextSeq 500 High Output v2.5 Kit (75 cycles) (Illumina Inc., catalog number 20024906).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... using NextSeq500/550 High Output v2.5 Kit (Illumina) to obtain single-end 75 nt reads ...
-
bioRxiv - Cell Biology 2019Quote: ... using NextSeq High Output Kit v2.5 reagents (Illumina). Raw data is in process of being deposited into Gene Expression Omnibus (GEO accession #TBD).
-
bioRxiv - Cell Biology 2020Quote: ... using NextSeq High Output Kit v2 reagents (Illumina). Raw and processed data are publicly available in the Gene Expression Omnibus (GSE144933 ...
-
bioRxiv - Cell Biology 2020Quote: ... using NextSeq High Output Kit v2.5 reagents (Illumina). Libraries for RNA-seq experiments shown in Fig ...
-
bioRxiv - Developmental Biology 2019Quote: ... using the 150 cycles high output kit (Illumina).
-
bioRxiv - Neuroscience 2019Quote: ... using NextSeq High Output Kit v2 reagents (Illumina).
-
Disruption of the TCA cycle reveals an ATF4-dependent integration of redox and amino acid metabolismbioRxiv - Biochemistry 2021Quote: ... the NextSeq 75 cycle high output kit (Illumina) was used and samples spiked in with 1% PhiX ...
-
bioRxiv - Systems Biology 2022Quote: ... using NextSeq High Output Kit v2 reagents (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... using the High-Output v2.5 Kit (20024906, Illumina) with 75 bp single-end reads.
-
bioRxiv - Plant Biology 2023Quote: ... and NextSeq 500/550 High Output Kit (Illumina). Reads were mapped as described and differential gene expression analysis was performed with edgeR (Robinson et al. ...