Labshake search
Citations for Illumina :
1 - 50 of 691 citations for Erythromycin 90 95% Erythromycin A N N Dimethyl 13C2 ~90% 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... 10%(v/v) N,N-dimethyl formamide) and 1 μl of Tagment DNA Enzyme from Nextera Sample Preparation Kit (Illumina) were added to the DNA-beads complex and incubated for 70 sec at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... RNAseq data of 4 databases covering 66 healthy tissues (Uhlen: n=122 individuals, n=32 tissues65; GTEx: n=1,315 individuals, n=53 tissues66; Illumina body map ...
-
bioRxiv - Developmental Biology 2023Quote: ... P2 100 cycles (Read1-28; Read2-90; Index1-10; Index2-10) (Illumina, cat no. 20046811). Cell Ranger version 6 and version 7.1 (for batch 1 and batch 2 respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... and 90 bases for Read 2 (Illumina 20012862). A PhiX control library was spiked in at 0.2 to 1% ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and 90 samples were sequenced on a NovaSeq 6000 (Illumina Inc.) platform ...
-
bioRxiv - Microbiology 2021Quote: ... A 10% spike-in of 90 pM PhiX Control v3 (Illumina, Inc.) was added to the pooled 90 pM library and 20 μl of the resulting library was run on the iSeq 100 System using paired-end 150 bp sequencing with adapter removal ...
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... Both low density 15k SNP chip (SheepLD; n=2,956) and medium density 50k SNP chip (Ovine SNP50 BeadChip; n=3,889) were purchased from Illumina Inc ...
-
bioRxiv - Microbiology 2023Quote: Raw data generated from Illumina (n=22) and PacBio (n=2 ...
-
bioRxiv - Neuroscience 2020Quote: ... we used one batch of 20 ng of total photoreceptor (n = 8) RNA and 30 ng for the other three batches (n = 24) according to the manufacturer’s protocol (Illumina Platforms). For generating libraries from RPE samples we used 20 ng of RNA ...
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Each clone (n=22) was sequenced by Illumina with 150pb paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each clone (n=15) was sequenced by Illumina with 150pb paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... a selection of 288 Enterobacterales recovered from water (n=155) and wastewater (n=133) samples underwent paired-end short read sequencing using Illumina (Illumina, USA) NovaSeq 6000 or MiSeq platforms ...
-
bioRxiv - Genomics 2020Quote: ... using 5% PhiX without dark cycles (n = 11) or 10-20% PhiX with 7 dark cycles (protocol provided by Illumina, n = 49). A maximum of 12 samples were pooled in one sequencing run resulting in 19.05 million [17.05 – 21.72] single-end reads per sample on average (supplementary table 3).
-
bioRxiv - Neuroscience 2021Quote: ... We used TruSeq Stranded mRNA kits (Illumina P/N 20020594) to prepare the stranded mRNA libraries ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 20 libraries containing 95 biological replicates were sequenced targeting 90% mRNA and 10% hashtag oligo library (50,000 reads/cell) on a HiSeq4000 or NovaSeq6000 (Illumina) platform with the recommended read lengths by 10X Genomics workflow.
-
bioRxiv - Developmental Biology 2022Quote: ... PhiX Control v3 adapter-ligated library (Illumina p/n FC110-3001) was spiked-in at 1% by weight to ensure balanced diversity and to monitor clustering and sequencing performance ...
-
bioRxiv - Physiology 2019Quote: ... (2019b) using 90 ng total RNA input to the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, California, USA). For multiplexing ...
-
bioRxiv - Genomics 2022Quote: Tn5 integration was performed as previously published 90 on purified nuclei using the Nextera Illumina kit (Illumina, FC 121 1031) at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: Tagmentation with Tn5 transposase was performed on 90 ng aliquots of the cDNA library using an Illumina DNA Prep kit (Illumina, 20018704) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... The TruSeq RNA Sample Preparation Kit (Illumina, Cat. N°RS-122-2002, USA) was used for library preparation (1 µg total RNA) ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=84 genotyped animals retained after quality control of the Illumina reads). Controls were animals which were lesion and culture negative for M ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=128 genotyped animals retained after quality control of the Illumina reads). An additional Fulani animal was also genotyped but we did not have any information on its M ...
-
bioRxiv - Genomics 2019Quote: ... Library preparation and sequencing were performed to generate 90 nt long reads in paired-end mode with sufficient sequencing depth (>30x) via HiSeq-2000 platform (Illumina, San Diego, USA).
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Bioengineering 2023Quote: ... Sequencing was performed in paired-end mode with HighOutput flow cell (read 1: 28 cycles and read 2: 90 cycles) and a NextSeq 550 sequencer (Illumina, San Diego, CA, USA) at the Transcriptome Core Facility of the Institute in Regenerative Medicine and Biotherapy ...
-
bioRxiv - Genomics 2022Quote: Multi-omics data utilized in JHS analyses including methylomics (n = 1,750, Illumina MethylationEPIC BeadChip array) [40] and proteomics (n = 2,144 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... 300pM of the pooled library was loaded onto a NovaSeq S1 flowcell (Illumina p/n 20012865), using the Standard Workflow loading conditions designated by the manufacturer and amplified by exclusion amplification (ExAMP ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Microbiology 2019Quote: ... denatured with 0.1 N NaOH and after dilution loaded in a MiSeq Reagent kit V2-500 (Illumina) at 8 pM concentration ...
-
bioRxiv - Cell Biology 2019Quote: ... the libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library and on average a minimum of 30,000 reads per single-cell.
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 2017 (n = 11) were prepared into two Illumina TruSeq LT libraries (Illumina, Inc. San Diego, CA), and sequenced on two Illumina NextSeq500 runs.
-
bioRxiv - Genomics 2020Quote: ... All other bulls (N = 3679) were genotyped at approximately 50,000 SNPs using medium density (MD) chips (e.g., the Illumina BovineSNP50 bead chip that comprises 54,001 (version 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array data (either Illumina human methylation27K array, n = 15 genomes; or Illumina human methylation450K array ...
-
bioRxiv - Physiology 2020Quote: Sequencing libraries (n=167) were prepared with the TruSeq Stranded mRNA HS kit (Illumina, San Diego, California, USA). The 2100 Bioanalyzer using the DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
bioRxiv - Cell Biology 2019Quote: ... The sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) and Qubit 3.0 with dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... 30 libraries (n=15 for each group) were constructed using the HiSeq Library Preparation kit (Illumina, San Diego, USA) and sequenced using Illumina NovaSeq™ ...
-
bioRxiv - Cancer Biology 2022Quote: mRNA libraries of the mouse melanoma tumor (n = 12) samples were prepared and sequenced using the HiSeq 2000 (Illumina). RNAseq data were processed by pyflow-RNAseq (Tang ...