Labshake search
Citations for Illumina :
1 - 50 of 3518 citations for DNA Standards since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Standard Nextera DNA library protocol (Illumina) was used to fragment the cDNA and add sequencing barcodes ...
-
bioRxiv - Molecular Biology 2019Quote: ... The DNA library was prepared using the standard Nextera XT DNA library preparation protocol (Illumina). A total of 1 ng of input DNA for each sample was added to the reaction buffer which fragments the input DNA and adds adapter sequences to the ends to allow for PCR reactions downstream in the library preparation process ...
-
bioRxiv - Genomics 2021Quote: ... Each Standard Flex library was constructed using all standard kit reagents from the Nextera DNA Flex Library Prep kit (Illumina, USA), following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A whole-genome shotgun library was constructed using standard procedures (TruSeq DNA; Illumina) and quantified using real-time PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DNA libraries for Illumina sequencing were generated by using standard protocols (Illumina) Libraries were sequenced on a NovaSeq 6000 S4 platform with 2 x 150 bp read length to 30 times base coverage.
-
bioRxiv - Genetics 2023Quote: ... Purified PCR products were prepared for sequencing using the standard Illumina DNA Prep protocol and reagents (Illumina DNA Prep (M), IPB) ...
-
bioRxiv - Genomics 2022Quote: ... Both DNA and RNA pair-end followed with standard protocol and were sequenced by Illumina HiSeq 2500 (Illumina ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA libraries were prepared according to a standard protocol and sequenced on MiniSeq platform (Illumina) with paired-end 150 cycles (75 + 75) ...
-
bioRxiv - Genomics 2023Quote: Whole genome DNA library preparation was performed using 100 ng DNA as input according to the standard protocol for Nextera DNA Flex Library Prep (Illumina, CA, USA) using Nextera DNA CD Indexes (Reference Guide 1000000025416.v07 ...
-
bioRxiv - Genomics 2019Quote: Genomic DNA material was used for the preparation of two standard TrueSeq Illumina libraries (Illumina Inc) with an average size of 360 and 747 bp ...
-
bioRxiv - Microbiology 2023Quote: ... Germany) after preparing sequencing libraries using standard paired-end genomic DNA sample prep kit from Illumina. Genome sequences were compared with that of the parent M ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite converted DNA was then put through the standard Infinium HD array based methylation assay (Illumina) with Illumina Infinium HumanMethylation EPIC BeadChips ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Microbiology 2024Quote: ... USA) after preparing sequencing libraries using standard paired-end genomic DNA sample prep kit from Illumina. Paired-end sequence data was collected with a read length of 150 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... and ligated to single-end adapters following the standard Illumina genomic DNA protocol (FC-102-1002, Illumina). After agarose size-selection to remove unligated adapters ...
-
bioRxiv - Molecular Biology 2021Quote: ... ChIP-derived DNA fragments were submitted for further manipulation by standard ChIP-seq library preparation techniques (Illumina) and Advanced Sequencing on an Illumina NextSeq 500 sequence analyzer as 75 bp single-end reads.
-
bioRxiv - Genomics 2022Quote: ... each in one lane of an Illumina HiSeq 4000 platform at the UC Davis DNA Technologies Core and according to the manufacturer’s standard protocols (summary statistics of Illumina re-sequencing data per sample is available in Supplementary Table 1).
-
bioRxiv - Genomics 2023Quote: ... following the manufacturer’s instructions and using a custom-made series of standards obtained from serial dilutions of the PhiX DNA (Illumina). Next ...
-
bioRxiv - Pathology 2019Quote: ... Libraries were prepared using the TruSeq standard total RNA kit with standard protocols (Illumina). 2 × 125bp paired-end sequencing was performed on an Illumina HiSeq 2500 sequencer ...
-
bioRxiv - Immunology 2021Quote: ... The immunoprecipitated DNA was processed into a standard Illumina ChIP-seq library and sequenced on an Illumina HiSeq instrument (Illumina) generating 48 and 35 million 75-nt single-end (SE75 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Parental and prostate tumor-passaged chromosomal genomic DNA were sequenced following the standard Next Generation Sequencing NovaSeq 2×100 protocol (Illumina) and aligned against the parental LT2 and associated stable pSLT reference sequences (NCBI ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA was then bisulfite-treated according to standard protocols and loaded onto Infinium HumanMethylation450 BeadChip arrays (Illumina, San Diego, CA). Array images were scanned and raw methylation intensities were normalized and subjected to quality control according to cohort-specific procedures ...
-
bioRxiv - Immunology 2020Quote: ... 1 ng of cDNA was used to prepare a standard Nextera XT sequencing library (Nextera XT DNA sample preparation kit and index kit, Illumina). Samples were sequenced using HiSeq2500 (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... 1 ng of cDNA was used to prepare a standard NextEra XT sequencing library (NextEra XT DNA library prep kit and index kits; Illumina). Barcoded Illumina sequencing libraries (NextEra ...
-
bioRxiv - Immunology 2021Quote: ... 1 ng of cDNA was used to prepare a standard Nextera XT sequencing library (Nextera XT DNA sample preparation kit and index kit, Illumina). Whole-transcriptome amplification and sequencing library preparations were performed in a 96-well format to reduce assay-to-assay variability ...
-
bioRxiv - Genomics 2021Quote: ... following the manufacturer instructions and using a custom-made series of standards obtained from serial dilutions of the phi-X DNA (Illumina). Library pools were sequenced to an average of 9.5M 75bp PE reads ...
-
bioRxiv - Genomics 2020Quote: ... Library preparation was performed following the standard Illumina TruSeq Nano DNA protocol for 350 base pair libraries (Illumina, San Diego, CA). A total of 100ng of amplicons from the ARTIC protocol were used as the input for library preparation ...
-
bioRxiv - Microbiology 2022Quote: ... Total DNA was used to construct Illumina paired-end sequencing library according to the manufacturer’s standard protocol (Illumina, San Diego, CA). Then ...
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712) as follows:
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712). The sequences for the primer sets were used for the libraries cloned into pRDA-052 or pRDA-550 are listed below:
-
bioRxiv - Plant Biology 2024Quote: ... DNA eluted from Chromatin-immunoprecipitated was prepared for library construction by using NEBNext® Ultra™ II DNA Library Prep with Sample Purification Beads according to standard operating procedures and then sequenced using HiSeq2000 (Illumina). Paired-end raw reads were first mapped to the Arabidopsis genome (TAIR10 ...
-
bioRxiv - Microbiology 2019Quote: ... using the standard HiSeq 2000 (Illumina) protocol ...
-
bioRxiv - Genomics 2023Quote: ... 1x standard storage buffer (Illumina Inc.), and 5 μM short SBS oligo (a final concentration of 1 μM SBS after resuspending nuclei in 10X Master Mix ...
-
Multi-omics analysis reveals signatures of selection and loci associated with complex traits in pigsbioRxiv - Genomics 2023Quote: ... Total RNA for RNA-seq and DNA for WGBS was extracted using the standard procedures and were sequenced on the Illumina HiSeq X Ten platform (Illumina, CA, USA). Both WGBS and RNA- seq libraries were performed in three biological replicates at each developmental stage ...
-
bioRxiv - Neuroscience 2021Quote: ... according to the standard manufacturer’s protocol (Illumina). For RNA-seq data analysis ...
-
bioRxiv - Microbiology 2022Quote: ... according to the standard manufacturer’s protocol (Illumina). Transcripts obtained were assembled using rnaSPAdes software ...
-
bioRxiv - Neuroscience 2023Quote: ... according to the standard manufacturer’s protocol (Illumina). For RNAseq data analysis ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The libraries for Illumina sequencing were constructed according to standard protocols using the Illumina DNA prep kit and IDT 10 bp UDI indices (Illumina, San Diego, CA, USA) by the sequencing facility at SEQCENTER (PA ...
-
bioRxiv - Systems Biology 2020Quote: ... iScan system and standard reagent and protocols (Illumina). Genotypes were pre-phased with ShapeIT2 and imputed with IMPUTE2 ...
-
bioRxiv - Genetics 2020Quote: ... according to the standard protocol provided by Illumina, Inc ...
-
bioRxiv - Molecular Biology 2022Quote: ... The library preparation followed the standard procedure (Illumina). The libraries were sequenced on the Illumina NovaSeq 6000 platform using the 150-bp paired-end sequencing strategy ...
-
bioRxiv - Genomics 2023Quote: ... WGS libraries were generated using standard protocols (Illumina). Libraries were sequenced to 15-30x genome coverage (2×150bp ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing libraries were prepared using standard Nextera adapters (Illumina) according to the supplier’s recommendations ...
-
bioRxiv - Genetics 2021Quote: ... and methylomic profiling was read out by Illumina iScan System as per the manufacturers’ standard protocol (Illumina). The technical schemes ...
-
bioRxiv - Plant Biology 2022Quote: ... involved standard protocols from the manufacturer (Illumina Inc., USA).
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were amplified 15 cycles while incorporating standard Nextera (Illumina) barcodes (1µL of 25 µM primer i5:i7 in 25 µL PCR reaction per well).
-
bioRxiv - Genetics 2021Quote: ... and libraries were constructed according to a standard protocol (Illumina) and sequenced on the Illumina HiSeq X-ten system ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the standard manufacturer’s protocol (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2023Quote: ... according to the standard manufacturer’s protocol (Illumina, San Diego, CA). The raw sequence reads were aligned to human genome hg38 (ensembl_GRCh38 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were prepared by using a TruSeq standard mRNA kit (Illumina) following manufacturer’s instructions ...