Labshake search
Citations for Illumina :
1 - 50 of 9291 citations for Cow T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and cows were genotyped with the BovineSNP50 Beadchip (Illumina Inc). The genotype data for CattleGTEx animals were generated previously 4 and included a total of more than 6 million sequence variants imputed also using Run7 of the 1000 Bull Genomes Project ...
-
bioRxiv - Genomics 2022Quote: ... and cows were genotyped with the BovineSNP50 Beadchip (Illumina Inc). The genotype data for CattleGTEx animals were generated previously 14 and included a total of more than 6 million sequence variants imputed also using Run7 of the 1000 Bull Genomes Project ...
-
bioRxiv - Genetics 2021Quote: ... 371 cows were genotyped with BovineSNP50 v.2.0 array (Illumina Ca. USA). In the first quality control step ...
-
bioRxiv - Cancer Biology 2022Quote: ... ScRNA-seq libraries were prepared using the Next GEM Chromium single cell 3′ reagent kits V3.1 with feature barcode technology for cell surface protein (10x genomics) and sequenced using NextSeq 500 high output kits and Novaseq S4 PE100 kits (Illumina). scRNA-Seq data after standard quality control was aligned to the reference genome (mm10 ...
-
bioRxiv - Genomics 2021Quote: The DNA methylome data of HLA-DR+/CD3- and CD3+ cells was analyzed using the HumanMethylation450K (450K) BeadChip (Illumina, USA) array as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cell surface protein libraries were sequenced on the NextSeq 550 System (Illumina).
-
bioRxiv - Genetics 2019Quote: ... and 2,550 Tropical Composite (TC) cows and bulls genotyped using either the BovineSNP50 (Matukumalli et al. 2009)) or the BovineHD (Illumina Inc., San Diego, CA) that includes more than 770,000 SNP ...
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Immunology 2022Quote: Single cell polymerase chain reaction (PCR) and custom molecular biology protocols generated NGS sequencing libraries (MiSeq, Illumina) using automated workstations (Bravo ...
-
bioRxiv - Immunology 2024Quote: Amplified IgG heavy- and light-chain variable regions were sequenced on an Illumina MiSeq (600-base v3 kit; Illumina) and reads corresponding to the same plate/well location were combined into consensus sequences ...
-
bioRxiv - Immunology 2019Quote: ... Amplicon mixtures corresponding to 10:1 ratios of heavy chain + lambda: kappa were submitted for 300 forward × 250 reverse sequencing with MiSeq v3 kits (Illumina) at the Chan Zuckerberg Biohub Genomics Center ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ T cells were sequenced on a HiSeq 2500 or HiSeq 3000 sequencing system (Illumina paired-end multiplexing run ...
-
bioRxiv - Systems Biology 2022Quote: ... we sorted 500-1000 clonally expanded HLA-A2/YFV NS4b-specific CD8+ T cells directly into 22.5μl of ATAC-buffer (12.5μl 2× TD Buffer (Illumina), 0.5μl 1% Digitonin (Promega G9441) ...
-
bioRxiv - Immunology 2022Quote: ... and T cell mRNA targeted libraries were pooled together before sequencing on a NovaSeq6000 instrument (Illumina). For sequencing ...
-
bioRxiv - Genetics 2019Quote: Sequencing libraries were prepared using the truseq Nano DNA sample preparation kit (T FC-121-4001/4002, Illumina Inc) extracting 100 ng DNA for each sample ...
-
bioRxiv - Immunology 2020Quote: ... we obtained publicly available CD8+ T-cell derived genome wide DNA methylation profiles (K450 Illumina DNA methylation arrays) from two previously published adult patient cohort ...
-
bioRxiv - Developmental Biology 2021Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using the configuration 28-8-98 on a single-index-paired-end run ...
-
bioRxiv - Neuroscience 2022Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using 100 bp paired-end run at a depth of 65-100 million reads ...
-
bioRxiv - Immunology 2024Quote: ... Live purified CD4+ T cells were processed using OMNI-ATAC protocol and libraries sequenced using NextSeq 500 sequencer (Illumina).
-
bioRxiv - Genetics 2024Quote: The process of library construction involved the purification of messenger RNA from total RNA using magnetic beads attached to poly-T oligos (TruSeq RNA Sample Prep Kit v2, Illumina Inc.). Subsequently ...
-
bioRxiv - Genomics 2020Quote: Whole-genome DNA methylation measurement was performed on DNA from purified CD4+ T cells using Infinium MethylationEPIC BeadChip (Illumina 850K array) by the Center for Applied Genomics Genotyping Laboratory at the Children’s Hospital of Pennsylvania ...
-
bioRxiv - Genomics 2020Quote: ... was prepared from total RNA from a testicular tissue sample of one BSW bull homozygous for the mutant T-allele at Chr6:58373887 using the Illumina TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA, USA). The library was sequenced using an Illumina NovaSeq6000 instrument ...
-
bioRxiv - Genetics 2020Quote: The phage L cII−101 genome was sequenced at the University of Pittsburgh by dideoxy chain termination methods as described (Pedulla, Ford et al. 2003) and at New England Biolabs by Illumina techology (above) ...
-
bioRxiv - Microbiology 2022Quote: ... followed by polymerase chain reaction with primers containing Illumina adapters to construct DNA libraries for paired-end sequencing on a NextSeq machine (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... They were then quantified by quantitative polymerase chain reaction (qPCR) and sequenced on a NextSeq500/550 System (Illumina, San Diego, CA, USA) according to the manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... and BCR IgG heavy chain loci were performed at Repertoire Genesis Incorporation (Osaka, Japan) using an unbiased amplification method with MiSeq (Illumina, San Diego, CA, USA). Data processing ...
-
bioRxiv - Microbiology 2022Quote: ... The latter was quantified by real-time quantitative reverse transcriptase-polymerase chain reaction and then sequenced on a Illumina MiSeq system with 2 × 250bp paired-end reads (Illumina Inc., San Diego, CA, USA) at the GeT-PlaGe Platform (Toulouse ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated with the Chromium Single Cell ATAC Library & Gel Bead Kit (1000111) and sequenced using the NextSeq 500/550 High Output Kit v2.5 (Illumina) on an Illumina NextSeq 550 platform ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... The abundance of the guide RNAs in the T = 0 and T10 replicates was determined by Illumina Next Generation Sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... using an Illumina HiSeq Flow Cell v4 and TruSeq SBS Kit v4 (Illumina). Raw sequencing read data was processed using RTA version 1.18.61 and CASAVA 1.8.4 to generate FASTQ-files ...
-
bioRxiv - Developmental Biology 2022Quote: ... ATAC-seq libraries were generated from the cells using the Nextera Kit (Illumina), as previously reported (Buenrostro et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the NovaSeq 6000 SBS v1 Kit and an S4 flow cell (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... Hamilton using a NovaSeq SP flow cell with the 500 cycle kit (Illumina) and 5% PhiX spike in ...
-
bioRxiv - Cancer Biology 2019Quote: ... Single cell library preparation was performed using a Chromium Single Cell 3’ Reagent Kit v3 (10X Genomics) and sequenced by Illumina HiSeq ...
-
bioRxiv - Cancer Biology 2021Quote: ... for single-cell RNA sequencing (with the 10X Genomics single-cell gene expression kit, a 400M read flow cell & single-end read using HiSeq from Illumina). 2,453 cells were sequenced with an average of 64,404 reads (and 3,457 genes ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... RNA-sequencing libraries were then prepared from RNA isolated from the bulk mutant AML bone marrow cells and the normal CD34+ bone marrow cells using TruSeq Stranded Total RNA kit (Illumina) described above ...
-
bioRxiv - Immunology 2022Quote: Samples were prepared using a Chromium Single Cell 3’ Reagent Kit (10x Genomics) and run on a NovaSeq S4-200 cell (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: ... libraries were constructed with Single Cell 3ʹ Reagent Kits v2 before sequencing by Illumina Novaseq.
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Genomics 2021Quote: ... Bulk cell line libraries were sequenced on the NextSeq using the Mid-Output kit (Illumina). Cord blood ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina). cDNA from each sample was amplified and barcoded in a mild stringency PCR (20 cycles of 30 seconds at 98°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 1 ng of cDNA per cell was transformed into a single-cell library using the Nextera XT DNA Library prep kit (Illumina FC-131-1096) and following the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA 95051 USA. mRNA was isolated using poly T beads, whereafter Illumina libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Genomics 2020Quote: ... Lysed cells were then transposed using the Nextera DNA library prep kit (Illumina #FC-121-1030) for 30 min at 37C ...
-
bioRxiv - Microbiology 2021Quote: Clusters were generated on a flow cell within a cBot using the Cluster Generation Kit (Illumina). Libraries were sequenced as 50 bp-reads on a HiSeq 2500 using the sequence by synthesis technique (Illumina) ...