Labshake search
Citations for Illumina :
1 - 3 of 3 citations for Complement anaphylatoxin C5a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... converted to the reverse-complement stranded Illumina sequencing library using the ScriptSeq Complete Kit (Bacteria, Illumina) and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre ...
-
bioRxiv - Genomics 2021Quote: ... As it is not recommended to use the tandem complement barcodes on the Novaseq platform (Illumina tech support, pers. comm.), only 9,120 of the 9,216 possible barcode combinations can be used out of the barcode v0 design barcodes.
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...