Labshake search
Citations for Illumina :
1 - 50 of 627 citations for Calcium calmodulin Dependent 3' 5' Cyclic Nucleotide Phosphodiesterase 1C PDE1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides (Trimmomatic37: a flexible trimmer for Illumina sequence data). Reads were aligned versus Ensembl mouse genome version mm10 (Ensembl release 101 ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Microbiology 2022Quote: ... nucleotides in italic represent the Nextera (Illumina) adapter ...
-
bioRxiv - Developmental Biology 2024Quote: ... 75-nucleotide sequence reads generated by Illumina sequencing (NextSeq 500 ...
-
bioRxiv - Molecular Biology 2023Quote: Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides (Bolger et al., Trimmomatic: a flexible trimmer for Illumina sequence data). Reads were aligned versus Ensembl human genome version hg38 (Ensembl release 104 ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Genomics 2021Quote: ... Nucleotide sequences were obtained with a MiSeq instrument (Illumina) in the paired-end 301 bp mode ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Genomics 2020Quote: ... One hundred nucleotides were sequenced using the HiSeq platform (Illumina) from both ends of each cDNA and sequence reads were aligned against the Saccharomyces cerevisiae S288c reference genome using Tophat2 aligner (Kim et al ...
-
bioRxiv - Cell Biology 2020Quote: ... Single Nucleotide Polymorphism array Infinium Core-24 v1.1 Kit (Illumina) was used according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... One hundred nucleotides were sequenced using the HiSeq platform (Illumina) from both ends of each cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Genomics 2021Quote: ... Sequencing (single read 50 nucleotides) was performed using a HiSeq2500 (Illumina) with SBS (Sequence By Synthesis ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 75-nucleotide paired-end sequencing reads were generated (Illumina, HiSeq 3000) with 6-32 M reads per sample (Supplementary Table 2) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries underwent 100 nucleotide paired end sequencing on a NovaSeq 6000 (Illumina).
-
bioRxiv - Plant Biology 2023Quote: An Illumina Infinium SNP (Single Nucleotide Polymorphism) array (Illumina, Inc., San Diego, USA) developed by Plomion et al ...
-
bioRxiv - Plant Biology 2023Quote: ... mRNA stranded nucleotide libraries were created by fusing TruSeq RNA sequencing adapters (Illumina), followed by library amplification by PCR ...
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Genomics 2023Quote: ... The nucleotide sequences of the resultant libraries were determined using HiSeq 1000 (Illumina) in paired-end ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Genomics 2023Quote: ... cycle one begins with incorporation of the first nucleotide in Incorporation Mix (Illumina MiSeq), followed by incubation with shaking at 60°C for 3 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced using 100 nucleotide paired-end sequencing on a NovaSeq 6000 (Illumina).
-
bioRxiv - Molecular Biology 2019Quote: ... The fluorescent images were processed to nucleotide sequences using the analysis Pipeline supplied by Illumina.
-
bioRxiv - Genomics 2019Quote: ... DNA was genotyped at 719,665 single nucleotide polymorphisms (SNPs) using the HumanOmniExpress-24 BeadChip (Illumina). The SNP call rate was > 97% in all donors ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sequencing of 75 nucleotide-long paired-end reads was performed in a NextSeq-500 (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... Sequencing of 75 nucleotide-long single-end reads was performed in a NextSeq-500 (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Biochemistry 2021Quote: ... Libraries were sequenced using paired end sequencing length of 75 nucleotides on a HiSeq4000 machine (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: Single nucleotide polymorphism (SNP) arrays were performed on the Global Screening Array-24 v2-0 (Illumina) and scanned on an iScan (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were subjected to paired-end sequencing (53 nucleotides each) on NovaSeq 6000 (Illumina) using a NovaSeq 6000 SP Reagent Kit (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2019Quote: ... and the primers V3F - 5’-CCTACGGGNGGCWGCAG-3’ and V4R – 5’-GACTACHVGGGTATCTAATCC-3’ [28] with the addition of the appropriate Illumina Nextera XT overhang adapter sequences (Illumina, San Diego, CA, USA). Following purification using a magnetic bead capture kit (Ampure ...
-
bioRxiv - Microbiology 2021Quote: ... Single-end reads of 65 nucleotides (nt) in length were generated on a HiSeq2500 sequencing platform (Illumina). Reads were cleaned of adapter sequences ...
-
bioRxiv - Genomics 2022Quote: ... The genome integrity was assessed by a single nucleotide polymorphism-based karyotyping assay (Illumina, HumanOmniExpress-24 v1.1). The iPSCs were maintained in a defined E8 medium (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were sequenced using paired eind sequencing length of a 100 nucleotides on a HiSeq4000 machine (Illumina).
-
bioRxiv - Genomics 2021Quote: ... Nucleotide sequences of the libraries were determined with theHiSeq 2500 DNA sequencing system (Illumina, San Diego, CA) in paired-end ...
-
bioRxiv - Molecular Biology 2023Quote: CAGE libraries were sequenced using single end reads of 75 nucleotides on a NextSeq 500 instrument (Illumina). The obtained reads (CAGE tags ...
-
bioRxiv - Microbiology 2023Quote: ... An Illumina NextSeq sequencer was applied for generation of paired-end fragment reads (2 × 150 nucleotides) and bcl2fastq software (v2.17.1.14; Illumina) was applied for primary data analysis (base-calling) ...
-
bioRxiv - Genomics 2024Quote: ... Twenty individual resequencing datasets were downloaded from the European Nucleotide Archive (ENA: 150-bp paired-end, Illumina sequencing data ...
-
bioRxiv - Genomics 2024Quote: ... Paired end (2 × 250 nucleotides) sequencing of the library was performed in a Novaseq 6000 (Illumina Inc.) next-generation DNA sequencer ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...