Labshake search
Citations for Illumina :
1 - 50 of 50 citations for CRISPR Screening since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Infinium Global Screening Array MD v1.0 from Illumina. Genotype information on approximately 4 million single-nucleotide polymorphisms was obtained upon imputation (MAF> 5% and R2 > 0.3 for imputation quality) ...
-
bioRxiv - Genomics 2020Quote: ... or the Global Screening Array (Illumina, San Diego, CA, USA). Global ancestry was estimated by performing Principal Components Analysis (PCA ...
-
bioRxiv - Genetics 2020Quote: The Infinium Global Screening Array panel (Illumina, San Diego, CA), consisting of 660 thousands of SNPs ...
-
bioRxiv - Genetics 2023Quote: ... Genotyping was performed on the Infinium Global Screening Array (Illumina) by The IoPPN Genomics & Biomarker Core Facility at King’s College ...
-
bioRxiv - Immunology 2023Quote: Genotyping was performed on the Illumina Global Screening Array 24 v3 (Illumina). The vcf file exclusively containing chromosome 6 was used as an input for the Michigan Imputation Server Genotype Imputation HLA (Minimac4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Genotyping array was performed using Infinium Global Screening Array -24 v3.0 (Illumina) to evaluate genome integrity.
-
bioRxiv - Genomics 2019Quote: ... we are therefore able to reconstruct the entire CRISPR locus from Illumina paired-end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... The quality of the pooled-CRISPR-sgRNA library was verified by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: A genotyping of AIDA samples was performed using Infinium Global Screening Array (Illumina). SNPs on the nonPAR X chromosome were treated as diploid in males and heterozygous genotypes of such SNPs were converted into ‘missing’ with PLINK (v1.90b4.4)48 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mosaic CRISPR-edited mice were screened with targeted deep sequencing (Illumina MiSeq PE250) using the following primer sequences ...
-
bioRxiv - Genomics 2022Quote: ... Barcoded libraries were sequenced for a first screening on the NextSeq550 equipment from Illumina using a 2x75 run at either LANGEBIO’s genomics core facility (National Laboratory of Genomics for Biodiversity ...
-
bioRxiv - Genetics 2019Quote: Samples were genotyped using the Global Screening Array v.1.0 from Illumina (636,139 markers). Sample-based (missingness ...
-
bioRxiv - Genomics 2021Quote: Sample genotyping was performed using the Infinium Illumina Global Screening Array v3.0 (Illumina, 20030770) by the Broad Institute Genomic Services group ...
-
bioRxiv - Immunology 2021Quote: ... DNA was genotyped using the Illumina Global Screening Array v3.0+ multi disease bead chips (Illumina) and subjected to standard quality control filters ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by genome-wide genotyping using the Global Screening Array (Illumina, Inc., San Diego, CA). For a full description of genotyping ...
-
bioRxiv - Immunology 2022Quote: Samples were genotyped on the Infinium Global Screening Array (GSA)-24 v2.0 (Illumina, San Diego, CA), with 665,608 variants genotyped per sample ...
-
bioRxiv - Genomics 2021Quote: ... Subjects were genotyped using the Illumina Infinium Global Screening Array-24 v1.0 Beadchip (Illumina, California, U.S.) following standard protocols ...
-
bioRxiv - Cancer Biology 2020Quote: Single nucleotide polymorphism (SNP) arrays were performed on the Global Screening Array-24 v2-0 (Illumina) and scanned on an iScan (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... specifically selected because genotyping was performed on the same genotyping array (Illumina Infinium Global Screening Array) and at the same center (Broad Institute ...
-
bioRxiv - Genomics 2023Quote: ... A genotyping of COVID-19 and healthy samples was performed using Infinium Asian Screening Array (Illumina) through collaboration with Japan COVID-19 Task Force (https://www.covid19-taskforce.jp/en/home/) ...
-
bioRxiv - Genetics 2020Quote: ... two of the largest providers using SNP array platforms (Illumina Infinium Global Screening Array5 and custom Illumina OmniExpress Plus Genotyping BeadChip,6 respectively) ...
-
bioRxiv - Genetics 2023Quote: Genome-wide SNP array was performed using the Infinium Global Screening Array-24 v3.0-EA-MD (Illumina), following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Genome-wide genotyping was performed using Global Screening Array 24 version 2 (Illumina, Inc., San Diego, CA, USA) at the Life & Brain facilities ...
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2022Quote: ... The isolated DNA samples were sent to the Center for Applied Genomics at the Children’s Hospital of Philadelphia for the SNP array analysis using the Infinium Global Screening Array-24 v3.0 Kit (Illumina). The chromosome copy number analysis was performed as described previously22 ...
-
bioRxiv - Immunology 2023Quote: ... Genotyping was carried out using DNA derived from each individual donor using the Infinium Global Screening Array (GSA) v2.0 BeadChip (Illumina) and performed by Macrogen (Korea) ...
-
bioRxiv - Genomics 2022Quote: Genome-wide SNP data from the Illumina Infinium Global Screening Array-24 v1.0 Beadchip (GSA array; Illumina, California, USA) was available for MMNP ...
-
bioRxiv - Neuroscience 2024Quote: We measured the genotype of SNP across the genome using the Infinium Global Screening Array-24 v3.0 Kit (Illumina) with the same extracted DNA samples used for the DNA methylation measurement ...
-
bioRxiv - Cancer Biology 2024Quote: ... The isolated DNA samples were sent to the Center for Applied Genomics at the Children’s Hospital of Philadelphia for the SNP array analysis using the Infinium Global Screening Array-24 v3.0 Kit (Illumina), which enabled the sequencing of 759,993 SNPs across the genome ...
-
bioRxiv - Genetics 2022Quote: ... Common bi-allelic SNP genotyping was performed using Illumina Global Screening Array SNP-microarray technology (Illumina, San Diego, California, USA). Genotype assignment from the microarray fluorescence data was performed using Illumina’s Genome Studio software.
-
bioRxiv - Genetics 2021Quote: WGS of constitutional DNA was performed using the Illumina HiSeq platform as described previously.1 Targeted MBD4 mutation screening was performed (i) using a custom MIP capture panel and sequenced on a NextSeq500 (Illumina) system ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA samples for available twin participants were genotyped using the Infinium Global Screening Array-24 v3.0 BeadChip (Illumina, California, USA). Genotyping data is expected to be available in 2023 ...
-
bioRxiv - Genomics 2024Quote: ... Total of 778,783 single nucleotide polymorphisms (SNPs) were genotyped on Infinium Global Screening Array MG v3.0 (Illumina, San Diego, CA) by the local service provider (Macrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µl 100 µM barcoded CRISPR KO primer (oMCB1440, aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACAC GTCTGAACTCCAGTCAC NNNNNN CGACTCGGTGCCACTTTTTC, where NNNNNN is an Illumina TruSeq index), and 69.4 µl nuclease-free water were added to the 5 µl PCR1 reaction ...
-
bioRxiv - Genomics 2020Quote: ... a total of 936 DNA samples were sent for genome-wide SNP genotyping using the Infinium Global Screening Array (GSA) with Shared Custom Content (Illumina Inc.). After extensive QC and imputation ...
-
bioRxiv - Neuroscience 2019Quote: Buccal swab and saliva samples were collected for DNA extraction followed by genome-wide genotyping using the “Global Screening Array” (Illumina, Inc). For a full description of genotyping and post-genotyping methods ...
-
bioRxiv - Genetics 2022Quote: ... Genotyping was performed with the Illumina Infinium Global Screening Array 1.0 with MDD and Psych content (Illumina, San Diego, CA, USA) at the Life & Brain facilities (Bonn ...
-
bioRxiv - Genomics 2019Quote: ... resulted in 936 DNA samples of sufficient quality and quantity to attempt genome-wide SNP genotyping using the Infinium Global Screening Array (GSA) with Shared Custom Content (Illumina Inc.). GSA genotyping was performed at the Institute of Clinical and Medical Biology (UKSH ...
-
bioRxiv - Genomics 2021Quote: ... Genome-wide SNP genotyping data were generated from the same samples using the “Global Screening Array” (GSA) with shared custom content (Illumina, Inc.) using procedures outlined in Hong et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and the University of California Los Angeles) on three genotyping platforms (Illumina Human660W, Illumina OmniExpress 2.5, and Illumina Global Screening Array) in 10 total batches (Supplementary Figure 1) ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was performed using single nucleotide polymorphism (SNP) microarrays (Infinium Global Screening Array v2.4. or Infinium OmniExpress-24; Illumina, San Diego, CA). Raw genotype files were converted to PLINK-compatible files using GenomeStudio software (Illumina ...
-
bioRxiv - Pathology 2021Quote: Genotyping was performed using single nucleotide polymorphism (SNP) microarrays (Infinium Global Screening Array v2.4. or the Infinium OmniExpress-24, Illumina, San Diego CA). Raw genotype files were converted to PLINK-compatible files using GenomeStudio software (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... Genotyping was carried out using the Illumina Infinium Global Screening Array 1.0 with MDD and Psych content (Illumina, San Diego, CA, USA) at the Life & Brain facilities ...
-
bioRxiv - Genomics 2019Quote: ... Genotyping for the discovery cohort was performed using the Illumina Global Screening Array-24 v1.0 BeadChip (Illumina, Inc., San Diego, CA, USA). Quality control for the SNP and individuals are described in the supplemental methods ...
-
bioRxiv - Genetics 2023Quote: ... additional OGM findings were confirmed with the SOC methods karyotyping and the Infinium Global Screening Array-24 v3.0-EA-MD (SNP-Array) (Illumina, San Diego, CA), according to standard protocols ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... The Illumina Global Screening Array platform was used (v3.0) (Infinium HTS Assay Reference Guide (# 15045738 v04) (Illumina, Inc. San Diego, CA, USA). Output data were analyzed in Illumina Genome Studio version 2.0 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... which were the Infinium Global Screening Array-24 Kit™ (GSA24) and the Infinium Global Diversity Array-8 Kit™ (GDA8) from Illumina and the Axiom™ Genome-Wide Human Origins (HO ...
-
bioRxiv - Genomics 2020Quote: ... Whole-genome genotyping was performed at the Helmholtz Zentrum München (Neuherberg, Germany) using the Illumina Global Screening Array v2 genotyping chip (Illumina, San Diego, California, USA). Single nucleotide polymorphisms (SNPs ...
-
bioRxiv - Immunology 2021Quote: SNP-array copy number profiling and analysis of regions of homozygosity were performed on DNA isolated from WT and CRISPR-Cas9 edited LCLs (ERAP2-KO) according to standard procedures using the Infinium Human CytoSNP-850K v1.2 BeadChip (Illumina, San Diego, CA, USA). Samples were scanned using the iScan system (Illumina) ...
-
bioRxiv - Pathology 2021Quote: ... The single nucleotide polymorphisms (SNPs) in BRSK2 gene region were genotyped by Infinium Asian Screening Array and Infinium Multi-Ethnic Global BeadChip (Illumina, Inc., San Diego, CA, USA), and SNPs passed through quality-control procedure (individual call rate >98% and approved with Hardy-Weinberg equilibrium ...