Labshake search
Citations for Illumina :
1 - 50 of 135 citations for Borrelia burgdorferi C t Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... C and D (Illumina). Amplicon concentration across samples was normalized to 200 ng/μl using the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Microbiology 2021Quote: ... 9) DC3000 − C (Illumina only), 10 ...
-
bioRxiv - Genomics 2020Quote: ... and Hi-C sequencing (Illumina sequencing). The tissue samples were stored in liquid nitrogen before sequencing ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Genomics 2019Quote: Raw Nanopore and Hi-C (Illumina) reads have been deposited in the NCBI SRA and are under the BioProject (PRJNA565796) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... as well as Hi-C (Illumina) chromatin interaction data ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ T cells were sequenced on a HiSeq 2500 or HiSeq 3000 sequencing system (Illumina paired-end multiplexing run ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Hi-C sequencing was performed by Illumina HiSeq 2500 platform ...
-
bioRxiv - Systems Biology 2022Quote: ... we sorted 500-1000 clonally expanded HLA-A2/YFV NS4b-specific CD8+ T cells directly into 22.5μl of ATAC-buffer (12.5μl 2× TD Buffer (Illumina), 0.5μl 1% Digitonin (Promega G9441) ...
-
bioRxiv - Immunology 2022Quote: ... and T cell mRNA targeted libraries were pooled together before sequencing on a NovaSeq6000 instrument (Illumina). For sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The abundance of the guide RNAs in the T = 0 and T10 replicates was determined by Illumina Next Generation Sequencing ...
-
bioRxiv - Genomics 2019Quote: ... and a single substitution error in the coding region was manually edited (c.14475 C>A, G184W) based on strong support from Illumina reads (data not shown) ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... 19bp single end sequencing (Illumina-C HiSeq 2500).
-
bioRxiv - Cancer Biology 2021Quote: ... All Hi-C libraries were sequenced by Illumina sequencing ...
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Immunology 2020Quote: ... we obtained publicly available CD8+ T-cell derived genome wide DNA methylation profiles (K450 Illumina DNA methylation arrays) from two previously published adult patient cohort ...
-
bioRxiv - Systems Biology 2019Quote: ... Set C: indexes 25–36 (Illumina, RS-200-0036), Set D ...
-
bioRxiv - Pathology 2024Quote: ... aphidicola (C, D) based on SNPs identified from Illumina sequencing ...
-
bioRxiv - Genetics 2019Quote: Sequencing libraries were prepared using the truseq Nano DNA sample preparation kit (T FC-121-4001/4002, Illumina Inc) extracting 100 ng DNA for each sample ...
-
bioRxiv - Immunology 2024Quote: ... Live purified CD4+ T cells were processed using OMNI-ATAC protocol and libraries sequenced using NextSeq 500 sequencer (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using the configuration 28-8-98 on a single-index-paired-end run ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA 95051 USA. mRNA was isolated using poly T beads, whereafter Illumina libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using 100 bp paired-end run at a depth of 65-100 million reads ...
-
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Genomics 2022Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... equimolar amounts of the libraries underwent a c-Bot (Illumina) bridge PCR followed by single end sequencing for 77 cycles on an Illumina Hiseq2500 ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Genomics 2023Quote: ... Illumina Nextera DNA Unique Dual Indexes Set C (Illumina, 20027215) were added and amplified (12 cycles ...
-
bioRxiv - Genomics 2020Quote: Whole-genome DNA methylation measurement was performed on DNA from purified CD4+ T cells using Infinium MethylationEPIC BeadChip (Illumina 850K array) by the Center for Applied Genomics Genotyping Laboratory at the Children’s Hospital of Pennsylvania ...
-
bioRxiv - Genetics 2024Quote: The process of library construction involved the purification of messenger RNA from total RNA using magnetic beads attached to poly-T oligos (TruSeq RNA Sample Prep Kit v2, Illumina Inc.). Subsequently ...
-
bioRxiv - Genomics 2019Quote: ... Hi-C libraries were prepared for sequencing on HiSeq 4000 (Illumina). After sequencing ...
-
bioRxiv - Genomics 2019Quote: ... and the Hi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... The pool was adjusted to 10pM for clustering on C-Bot (Illumina) and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... 62 °C for 5 min) using Nextera i5/i7 indexing primers (Illumina) and 2x KAPA HiFi HotStart ready-mix (KAPA Biosystems) ...
-
bioRxiv - Genomics 2020Quote: ... was prepared from total RNA from a testicular tissue sample of one BSW bull homozygous for the mutant T-allele at Chr6:58373887 using the Illumina TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA, USA). The library was sequenced using an Illumina NovaSeq6000 instrument ...
-
bioRxiv - Genomics 2019Quote: ... and the Promoter CHi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Genomics 2021Quote: We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
bioRxiv - Genomics 2020Quote: ... Hi-C libraries were paired-end sequenced on a NovaSeq 6000 system (Illumina). Raw data were processed with the ENCODE 4 pipeline for Hi-C according to ENCODE 4 standards (https://www.encodeproject.org/documents/75926e4b-77aa-4959-8ca7-87efcba39d79/).
-
Dual symbiosis in the deep-sea hydrothermal vent snail Gigantopelta aegis revealed by its hologenomebioRxiv - Genomics 2020Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... Hi-C libraries were sequenced 2×150bp on a NovaSeq 6000 instrument (Illumina). Juicer were used to process raw reads and generate Hi-C contact matrices (.hic files) ...
-
bioRxiv - Genetics 2022Quote: ... the products from each sample were bulked and applied to c-Bot (Illumina) bridge PCR followed by sequencing on Illumina Hiseq2500 ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp producing 32.08 Gbp of data in total (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2023Quote: ... Hi-C libraries were sequenced on Illumina NextSeq500 (Illumina, San Diego, CA, USA) platform using platform using High Output Kit v2.5 (150 Cycles).
-
bioRxiv - Genetics 2022Quote: ... Hi-C libraries were paired-end sequenced (61bp+61bp) on a NovaSeq 6000 (Illumina).