Labshake search
Citations for Illumina :
1 - 50 of 436 citations for 9 10 12 13 tetrahydroxyoctadecanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 9) DC3000 − C (Illumina only), 10 ...
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Genetics 2023Quote: ... to 9 uL of FSA (Illumina #20020599). After cDNA synthesis ...
-
bioRxiv - Systems Biology 2019Quote: ... Set B: indexes 13–24 (Illumina, RS-200-0024), Set C ...
-
bioRxiv - Microbiology 2021Quote: ... the pooled library was diluted to 9 pM and spiked with 15% of 9-pM PhiX prepared from PhiX Control Kit v3 (Illumina). The pooled library was then loaded on the MiSeq sequencer (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex, Deduped and Fivepercent methods and 10 for Illumina and 13 for NEB). We normalized the data using the DESeq2(40 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 13 pM library was loaded on the Illumina MiSeq® with 10% PhiX using a 2 × 300 bp V3 chemistry (Illumina Inc., CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... Metagenomic libraries were prepared for 13 samples following the manufacturer’s instructions (Illumina Inc.). Sequencing was performed on an Illumina NovaSeq 6000 platform with a 2 × 150 bp paired-end run at Berry Genomics Co ...
-
bioRxiv - Molecular Biology 2020Quote: ... 12 times 8 Nextera (Illumina) based primer combinations were used ...
-
bioRxiv - Immunology 2021Quote: Paired-end RNA-Sequencing was performed on two independent biological replicates of 10 or 12 pooled 4-dpf larval zebrafish per genotypic group (nlrc3l mutants versus their siblings) by Illumina HiSeq 2×100 basepairs ...
-
bioRxiv - Genetics 2019Quote: ... Patients with a diagnosis of FECD and scheduled for endothelial keratoplasty between the dates of 2/12/2013 and 10/27/2014 (for Illumina Infinium HumanMethylation450 BeadChip analysis ...
-
bioRxiv - Immunology 2020Quote: ... The transposed DNA was amplified by PCR for 10-12 cycles by using the Nextera DNA Library Preparation Kit and Nextera XT Indexing Kit (Illumina). The library DNA within the 150-to 500-bp range was enriched by AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2019Quote: ... single-end mode) at 12 pM loading concentration with 10% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: ... Probe sets (ILLUMINA HumanHT 12 V4) were assigned to gene names ...
-
bioRxiv - Neuroscience 2022Quote: ... 9-cycle PCR were performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... RNA with RIN > 9 were single-end sequenced on a HiSeq4000 platform (Illumina) with a minimum of 8 M reads per sample at a 50 nt read length ...
-
bioRxiv - Genomics 2022Quote: ... and 12% PhiX control library v3 (Illumina) was spiked into the library ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 9-cycle PCR was performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
Robust Cancer Mutation Detection with Deep Learning Models Derived from Tumor-Normal Sequencing DatabioRxiv - Genomics 2019Quote: ... and the last one was constructed by combining 9 NovaSeq sequencing replicates from Illumina to get a replicate pair with ∼390× coverage ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina). Libraries were prepared using an RNA Sample Prep V2 Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples of sufficient quality (RIN>9) were subjected to library preparation (Illumina Truseq mRNA kit) followed by sequencing using Illumina Novaseq 6000 (single read ...
-
bioRxiv - Bioengineering 2022Quote: ... amplified (13 cycles) and indexed for sequencing with the Nextera XT v2 DNA sample preparation kit (Illumina) using custom primers enabling 3’-targeted amplification ...
-
bioRxiv - Genomics 2021Quote: ... 11 kb and 13 kb) were prepared following Nextera protocol (Nextera Mate Pair sample preparation kit, Illumina). Each library was sequenced using 100 base-length read chemistry on a paired-end flow cell on the Illumina HiSeq2000 (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... amplified (13 cycles) and indexed for sequencing with the Nextera XT v2 DNA sample preparation kit (Illumina) using custom primers enabling 3’-targeted amplification ...
-
bioRxiv - Microbiology 2022Quote: ... Index PCR was performed with 13 cycles using IDT for Illumina Nextera DNA Unique Dual Indexes (Illumina). Obtained libraries were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2020Quote: ... of 34,363 (HT-12 v3 platform, Illumina_Human_WG-v3) probes representing 24,369 genes ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Immunology 2021Quote: ... Permeabilized cells were brought up to a volume of 9 μl in TD1 buffer (Illumina, 15027866) and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... The samples from the French estuaries (13, 35, 48, 78 and 79) we were sequenced using MiSeq (Illumina) by the company ID-Gene Ecodiagnostics (Geneva ...
-
bioRxiv - Cancer Biology 2021Quote: ... and gene expression (Illumina HumanHT-12 V4.0 expression beadchip) data from the Oslo cohort were obtained from the Gene Expression Omnibus (GSE68339) ...
-
bioRxiv - Immunology 2020Quote: ... Microarray was performed using the HumanHT-12 beadchip (Illumina, Inc. ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Systems Biology 2023Quote: ... we downloaded gene expression data (Illumina HT 12, EGAD00010000434) and miRNA expression data (Agilent ncRNA 60k ...
-
bioRxiv - Cancer Biology 2023Quote: ... and a microarray-based technology (Illumina HT-12 arrays) (30 ...
-
bioRxiv - Genetics 2020Quote: The phage L cI−40 13−am43 genome was sequenced at New England Biolabs by combining data from Illumina and PacBio RS2 methods ...
-
bioRxiv - Microbiology 2019Quote: ... library pooling according to Illumina protocols (13) and paired-end sequencing on a MiSeq instrument with MiSeq Reagent Kit v3 (MS-102-3003, Illumina). The indices for each sample are provided in Table S1
-
bioRxiv - Microbiology 2019Quote: Amplification and purification of V3-V4 regions of the 16S rRNA genes were performed according to the 16S Metagenomic Sequencing Library Preparation protocol (13) from Illumina ® with the following modifications ...
-
bioRxiv - Cancer Biology 2021Quote: ... 9 samples with DNA >40kbp were concurrently sequenced using PacBio and Illumina and the remaining 13 tumor samples were sequenced by Illumina WGS only ...
-
bioRxiv - Genomics 2021Quote: ... DNA was PCR amplified for a total of 11-13 cycles using barcoded primers (Illumina Nextera XT Index Kit v2) and purified using Ampure beads (1.4:1 beads:sample ratio) ...
-
bioRxiv - Genomics 2022Quote: Whole-genome shotgun libraries of 13 Capsicum lines were prepared with the TruSeq DNA PCR-Free Sample Prep Kit (Illumina), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... At least 1.5ug of total RNA (RIN>9) was prepared for stranded RNA sequencing using TruSeq kits (Illumina). Samples were poly(A)-enriched ...
-
bioRxiv - Microbiology 2022Quote: ... the purified amplicons were sequenced using the MiSeq reagent kit v2 (13 cycles) on the MiSeq platform (Illumina, Inc., CA, USA).
-
bioRxiv - Genomics 2022Quote: ... and diluted to 12 pM for sequencing on NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Immunology 2019Quote: ... Resultant cRNAs were hybridized onto HumanHT-12 v4 Expression BeadChips (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Gene expression data (cDNA microarray profiling, Illumina HT-12 v3 platform) from Molecular Taxonomy of BRCA International Consortium (METABRIC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity > 9) were selected for library preparation using the Illumina Stranded mRNA Prep Ligation protocol (Illumina, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... as per the manufacturer’s instructions and sequenced on an Illumina NextSeq500 machine with 13 libraries pooled at 1.8 pM using one High Output Kit v2 (Illumina #FC-404-2005) with 75 cycles single-end.
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were prepared from 9 biological replicates of each condition using the Truseq Stranded mRNA Library Prep Kit (Illumina #20020594) following manufacturer’s instructions and sequenced using the HiSeq-2500 sequencing platform (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... The pooled library contained three samples at 6 pM with 9% PhiX and was sequenced with a 50-cycle single-end MiSeq reagent kit (Illumina). The sequencing reads were aligned to the reference genome (NC 000913.3 ...