Labshake search
Citations for Illumina :
1 - 50 of 849 citations for 7 chloro 5 methylpyrazolo 1 5 A pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The library was diluted to a final concentration of 7 pM and 5% of PhiX DNA (Illumina, USA) was added ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Genomics 2020Quote: ... using 5% PhiX without dark cycles (n = 11) or 10-20% PhiX with 7 dark cycles (protocol provided by Illumina, n = 49). A maximum of 12 samples were pooled in one sequencing run resulting in 19.05 million [17.05 – 21.72] single-end reads per sample on average (supplementary table 3).
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...