Labshake search
Citations for Illumina :
1 - 50 of 437 citations for 7 Oxa 12 thia 3 aza spiro 5.6 dodecane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 3 to 12 µl of extracted RNA was depleted of rRNA using Ribo-Zero Gold H/M/R (Illumina) and then reverse-transcribed using random hexamers and SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Multiple mate-paired libraries (3, 8, 12 and 16 kb) were also constructed using the Nextera Mate-Paired Library Construction kit (Illumina). Libraries were sequenced on the Illumina HiSeq 2500 sequencer using the Illumina TruSeq PE Cluster kit v3 and TruSeq SBS kit v3 (101 ...
-
bioRxiv - Microbiology 2021Quote: ... 7) DC3000 − A (Illumina only), 8 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Genetics 2019Quote: ... The coding and splice-site regions of genes susceptible to hereditary arrhythmia and cardiomyopathies(10) were sequenced for probands II:3 and III-7 using Illumina HiSeq2500 Analyzer (Illumina, San Diego, CA, USA)(11) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries from 7 independent SCL-exo experiments were sequenced on 7 lanes of a HiSeq 1500 (Illumina) by the GEH facility (Rennes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 12 times 8 Nextera (Illumina) based primer combinations were used ...
-
bioRxiv - Genomics 2019Quote: ... Probe sets (ILLUMINA HumanHT 12 V4) were assigned to gene names ...
-
bioRxiv - Genomics 2022Quote: ... and 12% PhiX control library v3 (Illumina) was spiked into the library ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... of 34,363 (HT-12 v3 platform, Illumina_Human_WG-v3) probes representing 24,369 genes ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2022Quote: ... a SnakeMake pipeline to assemble sequencing data produced by Illumina (7). The pipeline integrates different quality control tools like FastQC (31 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and gene expression (Illumina HumanHT-12 V4.0 expression beadchip) data from the Oslo cohort were obtained from the Gene Expression Omnibus (GSE68339) ...
-
bioRxiv - Immunology 2020Quote: ... Microarray was performed using the HumanHT-12 beadchip (Illumina, Inc. ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Cancer Biology 2023Quote: ... and a microarray-based technology (Illumina HT-12 arrays) (30 ...
-
bioRxiv - Systems Biology 2023Quote: ... we downloaded gene expression data (Illumina HT 12, EGAD00010000434) and miRNA expression data (Agilent ncRNA 60k ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples with a RIN value of > 7 were used for library preparation (Illumina TruSeq Stranded Total RNA kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Genomics 2022Quote: ... and diluted to 12 pM for sequencing on NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Immunology 2019Quote: ... Resultant cRNAs were hybridized onto HumanHT-12 v4 Expression BeadChips (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Gene expression data (cDNA microarray profiling, Illumina HT-12 v3 platform) from Molecular Taxonomy of BRCA International Consortium (METABRIC ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Cell Biology 2020Quote: ... and hybridized on Illumina whole-genome HumanHT-12 v 4.0 chip (Illumina). Acquisition and data analysis were performed as previously described14 ...
-
bioRxiv - Genomics 2020Quote: ... Fragments were amplified with 12–18 cycles using adaptor specific primers (Illumina); fragments ranging between 300 and 500⍰bp in size were gel-purified before cluster generation and sequencing ...
-
bioRxiv - Neuroscience 2019Quote: ... and diluted to 12 pM for sequencing on the NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... these analyses were performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Cancer Biology 2021Quote: ... and mRNA expression was determined with the HT-12 v4 chip (Illumina, San Diego ...
-
bioRxiv - Genetics 2021Quote: ... whereas the Illumina Human HT-12 v4 beadchip (Illumina, San Diego, CA) is a genome-wide array targeting about 31,000 genes (with on average 2 probes per gene ...
-
bioRxiv - Systems Biology 2023Quote: ... and hybridized to HumanHT-12 v4 BeadChip microarrays (Illumina, BD-901-1001) as described previously20 ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Microbiology 2019Quote: ... mixed with the PhiX control library v3 (diluted to 7 pM; Illumina, San Diego, USA), and loaded on an Illumina MiSeq cartridge ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Genomics 2021Quote: ... The data was measured using the Illumina HT-12 v3 platform (Illumina_Human_WG-v3). This dataset included the mutation status of the TP53 gene ...
-
bioRxiv - Microbiology 2021Quote: ... 12-15 million sequence reads per sample were obtained on a HiSeq4000 (Illumina) with 150 bp read length.
-
bioRxiv - Genomics 2020Quote: ... cRNA samples were then hybridized to HumanHT-12 v3 Expression BeadChips (Illumina, Inc.).
-
bioRxiv - Pathology 2022Quote: ... The constructed 12 cDNA libraries were sequenced on Illumina HiSeqTM 4000 platform (Illumina). Raw data are available in NCBI Short Read Archive database (http://www.ncbi.nlm.nih.gov/sra/ ...