Labshake search
Citations for Illumina :
1 - 50 of 2176 citations for 7 Butyl 8 mercapto 1 3 dimethyl 3 7 dihydro purine 2 6 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Microbiology 2021Quote: ... 7) DC3000 − A (Illumina only), 8 ...
-
bioRxiv - Genetics 2019Quote: ... The coding and splice-site regions of genes susceptible to hereditary arrhythmia and cardiomyopathies(10) were sequenced for probands II:3 and III-7 using Illumina HiSeq2500 Analyzer (Illumina, San Diego, CA, USA)(11) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries from 7 independent SCL-exo experiments were sequenced on 7 lanes of a HiSeq 1500 (Illumina) by the GEH facility (Rennes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing was performed on a HiSeq 2000 series for 2 × 100 paired end reads with a 7 nucleotide read for indexes using Cycle Sequencing v3 reagents (Illumina). All regions were covered by >200 reads.
-
bioRxiv - Microbiology 2022Quote: ... a SnakeMake pipeline to assemble sequencing data produced by Illumina (7). The pipeline integrates different quality control tools like FastQC (31 ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Genetics 2019Quote: ... An average of 39.7 million 2 x 75 bp paired- end reads were generated for each sample on an Illumina NextSeq 500 (Illumina, Carlsbad, CA). FastQC was used to evaluate the quality of the reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Plant Biology 2021Quote: ... Samples with a RIN value of > 7 were used for library preparation (Illumina TruSeq Stranded Total RNA kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Genomics 2020Quote: ... Multiple mate-paired libraries (3, 8, 12 and 16 kb) were also constructed using the Nextera Mate-Paired Library Construction kit (Illumina). Libraries were sequenced on the Illumina HiSeq 2500 sequencer using the Illumina TruSeq PE Cluster kit v3 and TruSeq SBS kit v3 (101 ...
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were sequenced Paired-End 151 bases (in addition: 8 bases for index 1 and 8 bases for index 2) setup using the NovaSeq 6000 instrument (Illumina) and the S1 Flow-Cell loaded at a final concentration in Flow-Lane loaded of 340pM and including 1% PhiX.
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Paired-End 51 bases (in addition: 8 bases for index 1 and 8 bases for index 2) setup using the NovaSeq 6000 instrument (Illumina). SP Flow-Cell was loaded at a final concentration in Flow-Lane loaded of 400pM and including 1% PhiX ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Single-reads 76 bases (in addition: 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 (Illumina) using the NextSeq 500 High Output Kit 75-cycles (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Microbiology 2019Quote: ... mixed with the PhiX control library v3 (diluted to 7 pM; Illumina, San Diego, USA), and loaded on an Illumina MiSeq cartridge ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Neuroscience 2019Quote: ... Index 2: 8 cycles) across 2 runs on a NextSeq 500 (Illumina) with an average read depth across biological replicates of 8,815 reads per cell.
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...