Labshake search
Citations for Illumina :
1 - 50 of 402 citations for 6 Methyl 5 nitropicolinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Genomics 2021Quote: Methyl-seq-captured libraries were sequenced using a Hiseq2500 device (Illumina), by applying paired-end 125bp reads ...
-
bioRxiv - Genomics 2021Quote: The TruSeq Methyl Capture Epic kit was a gift from Illumina. Sequencing libraries were prepared according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 pM of DNA library spiked with .5% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina).
-
bioRxiv - Genetics 2024Quote: ... libraries were prepared using EpiGnome™ Methyl-Seq reagents (Illumina, Inc, San Diego, CA), index-tagged for multiplexing ...
-
bioRxiv - Genetics 2023Quote: ... The Illumina TruSeq Methyl Capture EPIC library prep kit (Illumina, Santa Clara, CA, USA) was used following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... We then randomly selected 2–3 scrambled-injected and 5–6 F0 knockout larvae for sequencing of the targeted loci (see Preparation of samples for Illumina MiSeq).
-
bioRxiv - Genomics 2021Quote: ... All DNA methylation data was generated using the TruSeq Methyl Capture EPIC kit (FC-151-1003, Illumina) according to manufacturer’s protocol [62] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 ng of ssDNA was used as input for the Epicenter EpiGnome™ Methyl-Seq Kit (Illumina, EGMK81312 ...
-
bioRxiv - Molecular Biology 2022Quote: Equimolar amounts of libraries for Enzymatic Methyl-seq were first sequenced on the iSeq 100 instrument (Illumina) using paired-end sequencing of 2x151 to assess both library and pooling qualities ...
-
bioRxiv - Genetics 2020Quote: ... Libraries were prepared with the Accel-NGS Methyl-Seq DNA Library Kit from Illumina (Cat No. 30096, Swift) and the sequencing was performed at Novogene (Hongkong ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Genetics 2020Quote: Whole genome bisulfite sequencing libraries were generated with the Accel-NGS Methyl-seq DNA Library Kit (Swift Biosciences) and sequenced on a HiSeq X10 (Illumina) in 150bp PE mode with PhiX spike-in to counteract low sequence diversity ...
-
bioRxiv - Cancer Biology 2022Quote: ... resistant and P12 cells of cell lines #3 and #9 was performed at the Genomics and Proteomics Core Facility of the German Cancer Research Center (GPCF DKFZ, Heidelberg) using the TruSeq DNA PCR-free Methyl protocol (Illumina) for library preparation ...
-
bioRxiv - Genomics 2023Quote: ... xGen Methyl-Seq Library kit was purchased from Integrated DNA Technologies and Nextera XT library prep kit was from Illumina, Inc.
-
bioRxiv - Systems Biology 2024Quote: ... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cleaned using Sample Purification Beads from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina, #FC-151-1002) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Genomics 2022Quote: ... Whole genome bisulfite sequencing libraries were prepared (according to Accel-NGS Methyl-Seq DNA library Kit for Illumina protocol, Swift Biosciences) and sequenced in 150 bp paired-end reads by Novogene company.
-
bioRxiv - Microbiology 2021Quote: ... 6) merged triplicates for DC3000 − (Illumina only), 7 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Neuroscience 2020Quote: ... and hybridized to MouseWG-6 v2.0 Expression BeadChips (Illumina). Raw data were preprocessed with quantile normalization in R/Bioconductor using the package beadarray ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Genetics 2021Quote: ... These 6 cats were sequenced on a HiSeq2500 (Illumina, San Diego, CA) to generate 100bp paired-end reads ...
-
bioRxiv - Neuroscience 2019Quote: ... and sequenced 6 samples per lane on a HiSeq 2000 sequencer (Illumina) giving a depth of 30-35 million reads per sample.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced at 101×6×0×101 on a HiSeq (Illumina) to a minimum depth of 30 million reads per sample.
-
bioRxiv - Immunology 2021Quote: ... and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96– Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified cDNA libraries were run on 6% Novex TBE gels (Illumina), and fragments running between 110-160 bp markers were gel-extracted for subsequent purification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... “alata” [6] from NCBI Sequence Read Archive (seven 101bp paired-end Illumina libraries ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Neuroscience 2021Quote: Total mRNA samples were used on MouseWG-6 v2.0 Expression BeadChips by Illumina. Differential expression was analyzed using direct hybridization analysis with quantile normalization ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 6 pM with 15% PhiX control DNA v3 (#FC-110-3001, Illumina) and sequenced on a MiSeq System (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Labelled cDNA were hybridised on a MouseWG-6 v2.0 Expression BeadChip (Illumina, USA) and gene expression analysis was performed using Partek software (Partek Incorporated ...
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...