Labshake search
Citations for Illumina :
1 - 50 of 2372 citations for 6 9 Methano 4 1 benzoxazepin 2 3H one octahydro 3 methyl 3 α 5a bta 6 bta 9 bta 9a bta 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... The pooled library contained three samples at 6 pM with 9% PhiX and was sequenced with a 50-cycle single-end MiSeq reagent kit (Illumina). The sequencing reads were aligned to the reference genome (NC 000913.3 ...
-
Robust Cancer Mutation Detection with Deep Learning Models Derived from Tumor-Normal Sequencing DatabioRxiv - Genomics 2019Quote: ... and the last one was constructed by combining 9 NovaSeq sequencing replicates from Illumina to get a replicate pair with ∼390× coverage ...
-
bioRxiv - Microbiology 2021Quote: ... 9) DC3000 − C (Illumina only), 10 ...
-
bioRxiv - Microbiology 2019Quote: ... RNA libraries were multiplexed and run across 9 lanes (infected tissues) or 3 lanes (uninfected tissues) for paired end sequencing by Illumina HiSeq 2500 at the University of Wisconsin Biotechnology Center ...
-
bioRxiv - Cancer Biology 2022Quote: ... performed the library preparation for WGS of parental and resistant cells of cell lines #3 and #9 as well as a control tail samples corresponding to line #3 with the TruSeq DNA PCR-free Kit (Illumina) and the 150 bp paired-end sequencing on a HiSeq X (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Genetics 2023Quote: ... to 9 uL of FSA (Illumina #20020599). After cDNA synthesis ...
-
bioRxiv - Microbiology 2021Quote: ... the pooled library was diluted to 9 pM and spiked with 15% of 9-pM PhiX prepared from PhiX Control Kit v3 (Illumina). The pooled library was then loaded on the MiSeq sequencer (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... before combining 6 samples into one flow cell for sequencing on a HiSeq 2000 sequencer (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Neuroscience 2022Quote: ... 9-cycle PCR were performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... RNA with RIN > 9 were single-end sequenced on a HiSeq4000 platform (Illumina) with a minimum of 8 M reads per sample at a 50 nt read length ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Developmental Biology 2019Quote: ... Up to 6 barcoded samples were pooled in one lane of the flow cell and sequenced by Illumina NextSeq 500 (MidOutput run) ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 9-cycle PCR was performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina). Libraries were prepared using an RNA Sample Prep V2 Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples of sufficient quality (RIN>9) were subjected to library preparation (Illumina Truseq mRNA kit) followed by sequencing using Illumina Novaseq 6000 (single read ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were 6-plexed and sequenced with 2×100bp reads on a HiSeq-4000 (Illumina). The data were mapped using BWA ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Plant Biology 2023Quote: Prepared libraries were pooled and diluted to 6 pM for TruSeq Paired End v4 DNA clustering on one single flow cell lane using a cBot device (Illumina). Final sequencing was carried out on an Illumina HiSeq 2500 platform using 126 ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Immunology 2021Quote: ... Permeabilized cells were brought up to a volume of 9 μl in TD1 buffer (Illumina, 15027866) and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 6) merged triplicates for DC3000 − (Illumina only), 7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Developmental Biology 2019Quote: ... At least 1.5ug of total RNA (RIN>9) was prepared for stranded RNA sequencing using TruSeq kits (Illumina). Samples were poly(A)-enriched ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of denatured PhiX control (prepared according to Illumina protocol, final concentration 1%) was added to the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity > 9) were selected for library preparation using the Illumina Stranded mRNA Prep Ligation protocol (Illumina, USA), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The GBS library was diluted to 3.6 pM and sequenced on one lane (single end, 101 base pair read length) of an Illumina HiSeq 2500 (Illumina Inc, San Diego, CA) at the Genomics Resources Core Facility (Weill Cornell Medicine ...