Labshake search
Citations for Illumina :
1 - 50 of 871 citations for 6 1 Azepanyl 3 pyridinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of denatured PhiX control (prepared according to Illumina protocol, final concentration 1%) was added to the library ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... 6 pM of DNA library spiked with 1% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced at Novogene on 1 HiSeq PE 150 lane (6 bp, i7 single index, Illumina). The output of the lane was 375 million reads.
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2021Quote: ... 6) merged triplicates for DC3000 − (Illumina only), 7 ...
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Genomics 2019Quote: ... and marker-wise (HWE P value > 1 × 10−6, call rate > 95%, and for the GSA array additionally by Illumina GenomeStudio GenTrain score > 0.6 ...
-
bioRxiv - Genomics 2019Quote: ... was isolated from 1 µg of total RNA and 6 RNA-Seq libraries were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on an Illumina HiSeq 2000 platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Microbiology 2023Quote: ... Multiplexing of sgRNA challenge screens in BCBL-1 was performed utilizing 6-bp indexes and sequenced on a single lane of a HiSeq4000 (Illumina) using 50bp single-end (SE ...
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Neuroscience 2020Quote: ... and hybridized to MouseWG-6 v2.0 Expression BeadChips (Illumina). Raw data were preprocessed with quantile normalization in R/Bioconductor using the package beadarray ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina sequencing libraries with 6-bp single indices were constructed from 1 μg total RNA using the TruSeq Stranded mRNA LT kit (Illumina, RS-122-2101). The resulting library was validated using the Standard Sensitivity NGS Fragment Analysis Kit (AATI ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification was carried out using 3 µl of NMP per sample and adding 1 µl of each dual-indexed (i7 and i5; Illumina) primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...