Labshake search
Citations for Illumina :
1 - 50 of 1164 citations for 5 MORPHOLIN 4 YLPENT 3 YN 1 OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2019Quote: ... and the primers V3F - 5’-CCTACGGGNGGCWGCAG-3’ and V4R – 5’-GACTACHVGGGTATCTAATCC-3’ [28] with the addition of the appropriate Illumina Nextera XT overhang adapter sequences (Illumina, San Diego, CA, USA). Following purification using a magnetic bead capture kit (Ampure ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: ... and reverse transcribed using 25 pmol RT primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’) for TRU-seq barcodes (RP1 primer, Illumina). A portion of the RT product was removed and used for trial amplifications to determine the optimal number of PCR cycles ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Developmental Biology 2019Quote: ... Pools of 4 or 5 multiplexed libraries were loaded per lane of a HiSeq 2000 sequencer (Illumina) at 8 pM and single-end sequenced using the 100 bp protocol.
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Cancer Biology 2022Quote: ... using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75) high-throughput sequencing using a NextSeq550 (Illumina).
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
bioRxiv - Biochemistry 2019Quote: ... double indexed libraries (Nextera XT indices) were prepared from recovered library DNA from rounds 3–5 and sequenced on a MiSeq platform (Illumina) using a v3 chip as single 151 cycle reads37 ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...