Labshake search
Citations for Illumina :
1 - 50 of 1580 citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... (M) Tagmentation Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Molecular Biology 2021Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Microbiology 2022Quote: ... (M) Tagmentation Kit (Illumina, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... (M) Tagmentation Kit (Illumina Co.), and sequencing was run with the MiSeq Reagent Kit v3 (2 × 300 bp) ...
-
bioRxiv - Genomics 2019Quote: ... For HapMap samples and three PGT-M families paired-end (2×125bp) sequencing was performed on a HiSeq2500 system (Illumina) in multiple runs ...
-
bioRxiv - Genomics 2022Quote: ... Samples were sequenced with a coverage of 50 M paired end reads (2 x 100 bp) /sample on a NovaSeq (Illumina).
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl amplified cDNA was tagmented in 1x Tagmentation Buffer using 0.8 μl bead-linked transposome (Illumina DNA Prep, (M) Tagmentation ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Genomics 2023Quote: ... Urine samples were then sequenced with (either the 2 x 150 bp or 2 x 75 bp configuration) to a mean depth of 30 M reads per sample on NextSeq 2000 (Illumina Inc); sequencing length did not impact gene detection efficiency (Supplementary Fig ...
-
bioRxiv - Genomics 2019Quote: ... with the flags -m 2 and -g to remove homopolymeric guanine repeats at the end of the reads (a systematic error of Illumina NovaSeq 6000).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Developmental Biology 2021Quote: ... m-z+ or m-z−) were selected for library construction using the Nextera XT DNA Library Preparation Kit (Illumina). The single embryo RNA-seq libraries were non-stranded and only PolyA+ RNA was captured ...
-
bioRxiv - Microbiology 2021Quote: ... (M) Tagmentation kit (Illumina, San Diego, California, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... followed by library preparation (Illumina DNA Prep, (M) Tagmentation ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Molecular Biology 2023Quote: Ribo-Zero Magnetic Kit H/M/R (Epicentre/Illumina) was used to remove ribosomal RNAs and to enrich mRNAs ...
-
bioRxiv - Genomics 2020Quote: ... We used Ribo-Zero Magnetic Kit H/M/R (Illumina) to remove rRNAs from total RNA samples for analyses of non-polyadenylated RNAs.
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicon library pool was diluted to 2 nM with sodium hydroxide and 5 mL were transferred into 995mL HT1 (Illumina) to give a final concentration of 10 pM ...
-
bioRxiv - Genomics 2019Quote: ... and three mate-pair libraries (insert sizes of 2 kb, 5 kb, and 8 kb) were constructed using the TruSeq PCR-free Kit (Illumina) and Mate-pair Kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ~2 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina) as previously described [79] ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2020Quote: ... 0.75 M sucrose) and R1804M Ready-Lyse lysozyme solution (Illumina, USA). After 15 minutes of incubation at 37°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and NextSeq 500 Mid Output Kit PE75 (120 M reads) (Illumina) were used following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Microbiology 2023Quote: ... The quantified and denatured libraries were sequenced using paired-end 2×250-bp chemistry with 5% PhiX as an internal control on the Illumina MiSeq 2000 platform (Illumina Inc., USA). The quality-filtered reads were de-novo assembled using SPAdes (version 3.11.1) ...
-
bioRxiv - Neuroscience 2020Quote: ... 400 M clustered flowcells (75 cycles) were sequenced with the NextSeq500 platform (Illumina) in 75bp single read mode ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Genomics 2021Quote: ... and four mate-pair sequencing libraries (insert sizes of 2, 5, 10, and 15 kb) in accordance with manufacturer protocols (Illumina, San Diego, CA, USA). Libraries were then sequenced using a HiSeq2000 instrument (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... and diluted to 5 pM prior to sequencing on an Illumina MiSeq platform with a 2 × 250 bp paired-end protocol (Illumina, San Diego, CA, USA). Sequencing reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Neuroscience 2019Quote: ... using the ScriptSeq Complete Gold Kit (H/M/R) (Illumina Inc., San Diego, CA). Samples were fragmented ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 µl BLT Bead-Linked Transposase (both contained in Illumina® DNA Prep, (M) Tagmentation Catalogue No 20018704 ...
-
bioRxiv - Bioengineering 2023Quote: The analysis for this paper was performed on 81 M raw reads from Illumina deep sequencing collected following the addition at four time points of the small molecule pomalidomide to a CRISPR library consisting of 48 well-characterized guide sequences ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.