Labshake search
Citations for Illumina :
1 - 50 of 1631 citations for 4 Phenyl 3 buten 2 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were processed using the 10x Genomics Chromium 3’ Gene Expression Solution (version 2) based on manufacturer instructions and sequenced using a NextSeq 500 sequencer (Illumina).
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... Biomark Access Array system followed by sequencing with 2×225 base pair reads on a MiSeq instrument using version 3 chemistry (Illumina, San Diego, CA). FASTQ files were processed through a custom bioinformatics pipeline (ScanIndel ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The library was pooled with other samples at equimolar concentrations and sequenced at 4 nM as single lanes on Illumina NovaSeq 6000 S4 platform (2×150; Illumina Inc., San Diego, CA). The library for long-read data was prepared using the Nanopore ligation kit ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.