Labshake search
Citations for Illumina :
1 - 50 of 530 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and quantified by qPCR using the KAPA SYBR Fast qPCR Master Mix (Illumina). Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was conducted using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on an RT-PCR system (Illumina Eco, California, USA). The primers used are listed in Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR gene expression quantifications were performed using AceQ qPCR SYBR Green Mix (Vazyme Biotech) on Eco Real-Time PCR System (Illumina, San Diego, CA). RNA expression was normalized to a geometric mean of two reference genes ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR reactions were performed using the Thunderbird® SYBR qPCR mix (TOYOBO) and Eco Real-Time PCR System (Illumina). The PCR primers used are listed in Supplementary Table S8 ...
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were resuspended in cold PBS and tagmentation master mix (25 ul of 2x tagmentation buffer, 2.5 ul of TDE1 [Illumina] ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR master mix containing NPM PCR mix (Illumina), 1X SYBR Green dye and uniquely indexed PCR primers were added to each well ...
-
bioRxiv - Developmental Biology 2021Quote: ... 25 mL of 2x NEBNext Ultra II Q5 Master Mix, 3 mL of 10 mM Universal PCR primer from Illumina, 3 mL of 10mM Index PCR primer and 9 mL of nuclease-free water and amplified for 10 cycles (98C for 10 s ...
-
bioRxiv - Genetics 2023Quote: ... dsODN specific PCR products were used for indexing PCR using 2x Platinum SuperFi PCR Master mix and i5 primer: AATGATACGGCGACCACCGAGATC and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... Transposed DNA fragments were purified using Qiagen Mini- Elute Kit and PCR amplified using NEB Next High Fidelity 2x PCR master mix (New England Labs) with dual indexes primers (Illumina Nextera). Genomic Alignment of sequencing reads ...
-
bioRxiv - Genomics 2023Quote: ... 12.5 μl of a master mix containing 7.5 μl of Nextera PCR Master Mix (Illumina, FC-131-1096) and 2.5μl of each Index primer i7 (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... 25 μl PCR master mix (Nextera, Illumina) and 5 μl indexed amplification primers59 (0.125 μM final concentration ...
-
bioRxiv - Immunology 2020Quote: ... The transposase reaction mix (2x transposase buffer, TDE1 enzyme (both from Illumina), 0.01% Digitonin (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were resuspended in transposition mix (25 µL 2x TD buffer (Illumina), 16.5 µL PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were resuspended in transposition mix (25 µL 2x TD buffer (Illumina), 16.5 µL PBS ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Pelleted nuclei were resuspended in 25μL Transposition mix (12.5μL 2x TD buffer (Illumina), 1.25μL transposase (100nM final ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were sequenced at low-pass (2x 50bp paired end) targeting 2 million reads on a NextSeq (Illumina) instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of transposition mix (7.5 μl 2X TD Buffer (Illumina, FC-121-1030), 2.05 μl 1X PBS ...
-
bioRxiv - Microbiology 2019Quote: ... 10 ng of DNA template was combined with PCR master mix (0.2 mM dNTP mix, 0.56 mg/ml BSA, 0.4 uM Illumina adapter sequence-tagged forward primer (515F ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nuclei pellets were resuspended gently in transposition reaction mix (25 µL 2X TD Buffer [Illumina Cat #FC-121-1030] ...
-
bioRxiv - Developmental Biology 2022Quote: ... The samples were then resuspended in 1 ml of ATAC mix (2X TDE buffer (Illumina), 50 µl TDE (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The transposition reaction mix (25 μl 2X TD buffer, 2.5 μl TDE1 Nextera transposase (Illumina), 16.5 μl PBS ...
-
bioRxiv - Genomics 2023Quote: ... and pellets were resuspended in the transposition reaction mix (25 µL 2X TD buffer (Illumina), 2.5 µL TDE1 Tn5 transposase (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... while other regions were quantified using oligonucleotide primers and SYBR green mastermix (Illumina). All mRNA levels were normalized to ActB or Hprt as indicated in Figure legends ...
-
bioRxiv - Bioengineering 2020Quote: ... Pelleted nuclei were resuspended in 25 μL Tn5 transposition mix (12.5 μL 2X Tagment DNA buffer, 1.25 μL Tn5 transposase, and 11.25 μL sterile water; Illumina) and stored in a shaking incubator at 37°C and 500 RPM for one hour ...
-
bioRxiv - Genetics 2021Quote: ... The pellet was then resuspended in the tagmentation reaction mix (25 μL 2X TD Buffer (Illumina, 15027866), 2.5 μL TD Enzyme (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... Pellets were resuspended in transposase reaction mix (25 μL 2x TD Buffer (Illumina Cat #FC-121-1030) 2.5 μL Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Neuroscience 2023Quote: ... the nuclei were extracted and resuspended with the transposase reaction mix (25 μl 2x TD buffer (Illumina); 2,5 μl Transposase (Illumina) ...
-
bioRxiv - Genomics 2024Quote: ... The nuclei were resuspended in transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121–1030, Nextera), 2.5 µl Tn5 Transposase (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... Nuclei were immediately resuspended in 25 μL of the transposition reaction mix (12.5μL 2x TD Buffer (Illumina), 1.25μL Tn5 Transposases ...
-
bioRxiv - Immunology 2021Quote: ... Cells were suspended in 50 uL of tagmentation master mix prepared from Illumina Tagment DNA TDE1 Enzyme and Buffer Kit components (#20034197) ...
-
bioRxiv - Genetics 2021Quote: ... 50,000 nuclei were incubated in the transposition reaction mix (20μl nuclease-free water; 25μl 2X Tagment DNA Buffer, Illumina Cat#FC-121-1030 ...
-
bioRxiv - Neuroscience 2021Quote: ... Beads were then resuspended in 25μL of tagmentation reaction mix containing 12.5μL of 2x Tagmentation DNA Buffer (Illumina #15027866) and 1μL of Tagment DNA Enzyme (Illumina #15027865) ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended in the transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121-1030, Nextera), 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Immunology 2020Quote: ... the pellet was resuspended in 50 μL ATAC reaction mix (25uL 2X TD buffer, 2.5 μL Nextera Enzyme, 22.5 μL water, Illumina). The transposase reaction was carried out at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting pellet was resuspended in transposase reaction mix (25μl cold lysisl 2x TD buffer, 10μl cold lysisl transposase (Illumina), 15μl cold lysisl nuclease-free H2O ...
-
bioRxiv - Cancer Biology 2022Quote: ... The transposition reaction mix (25μl of 2X TD buffer, 2.5μl of Tn5 transposase (Illumina, San Diego, CA, USA), 15ul of PBS and 7.5μl of nuclease free water ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cell pellet was then re-suspended in 50ml of transposition reaction mix (25ml 2x TD buffer (Illumina), 2.5ml transposase (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... DNA was tagmented by the addition of 10 µL of tagmentation mix (0.01 µL of a custom TDE1 enzyme in 9.99 µL of 2x Nexterda TD buffer, Illumina) and plates incubated at 55°C for 5 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were resuspended in 25uL of transposition mix (12.5ul 2x TD buffer, 1.25ul transposase (Illumina, catalog nr 20034197), 8.25ul PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were then resuspended in 50 μL transposition reaction mix containing 25 μL 2X Tagment DNA buffer (Illumina), 2.5 μL Tn5 transposase (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... The qualified libraries were then quantified by qPCR and sequenced by 2x 150 bp paired-end run on a Novaseq 6000 System (Illumina).
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Immunology 2019Quote: ... The nuclei pellet was resuspended in 50 μL transposition mix (25 μl 2x TD buffer, 2.5 μl transposase (Illumina), 16.5 μl PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The pellet was resuspended in transposase reaction mix (25 uL 2X TD buffer, 2.5 μL Transposase (Nextera DNA sample preparation kit, Illumina), and 22.5 μL H20 and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nuclei pellets were resuspended gently in transposition reaction mix (25 µL 2X TD Buffer [Illumina Cat #FC-121-1030], 2.5 µL transposase [Illumina Cat #FC-121-1030] and 22.5 µL nuclease-free water ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei pellets were then resuspended in 50 µl of transposition mix (2.5 µl Tn5 transposase, 25 µl 2x TD buffer (both Illumina), 0.5 µl 1% Digitonin (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... The pellet was resuspended in transposase reaction mix (25 µL 2X TD buffer, 2.5 µL Transposase (Nextera DNA sample preparation kit, Illumina), and 22.5 µL water and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Pelleted nuclei were resuspended in 50 μL transposition mix (25 μL 2x TD Buffer (Illumina (San Diego, CA, USA) 20034197) ...