Labshake search
Citations for Illumina :
251 - 300 of 1472 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... 10 ng of amplicon DNA from the first PCR reaction was combined with 10 µL of Nextera adapter index primers (Illumina Cat#20027213) and 25 µL Kapa HiFi Hotstart ReadyMix ...
-
bioRxiv - Cancer Biology 2021Quote: ... five microarray data sets that were quantified by Illumina beadchip were combined as the MIBC-ILLUMINA cohort ...
-
bioRxiv - Evolutionary Biology 2020Quote: The hybrid read set (both Illumina and ONT reads) for each isolate was assembled using Unicycler 0.4.0 (Wick et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TruSeq RNA Single Indexes Set A (Illumina, 20020492) were used to prepare two Scrambled and two Setd2 knockdown libraries from 900 ng of total RNA per library ...
-
bioRxiv - Zoology 2020Quote: ... but with TruSeq DNA Single Indexes (Set B, Illumina), following the manufacturers’ instructions up till the adapter ligation step ...
-
bioRxiv - Systems Biology 2019Quote: ... Set D: indices 37–48 (Illumina, RS-200-0048)) (TruSeq Small RNA Library Prep Kit Reference Guide (Illumina ...
-
bioRxiv - Systems Biology 2019Quote: ... Set C: indexes 25–36 (Illumina, RS-200-0036), Set D ...
-
bioRxiv - Systems Biology 2019Quote: ... Set B: indexes 13–24 (Illumina, RS-200-0024), Set C ...
-
bioRxiv - Cell Biology 2020Quote: ... and TruSeq RNA Single Indexes Set B (20020493, Illumina) according to standard Illumina library preparation procedure ...
-
bioRxiv - Genomics 2021Quote: The TruSeq DNA LT kit Set A (Illumina, #15041757) was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... Nextera XT v2 Index Sets (Illumina, #FC-131-2004) were diluted 1:5 in water prior to use ...
-
bioRxiv - Cell Biology 2022Quote: ... with TruSeq RNA Single Indexes Set A (Illumina, #20020493).
-
bioRxiv - Genomics 2024Quote: ... Datasets were separated into a training set (7 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genetics 2023Quote: ... (2014)[32] used 825 samples and the gene expression data were generated from Illumina Human HT-12 V3 BeadChips ...
-
bioRxiv - Cancer Biology 2019Quote: ... Products were amplified for 20 cycles using a common forward primer (NEBNext SR primer for Illumina) and barcoded reverse primers for each sample (NEBNext Index primers for Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... 1.5 ul 10 uM primer reporter-specific forward primer (adding the Illumina TruSeq Read 2 sequence) and 1.5 ul reverse primer (Illumina TruSeq Read 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Products were amplified for 12 cycles using a common forward primer (NEBNext SR primer for Illumina) and barcoded reverse primers for each sample (NEBNext Index primers for Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... Every sample was amplified using 100 nM of primer U2 (annealing to the Illumina PE1.0 primer) and one of indexing primers with Illumina PE2.0 sequence (UIND1-12) ...
-
bioRxiv - Molecular Biology 2023Quote: We designed two primer pools of 106 primer pairs with DesignStudio (Illumina, San Diego, CA, USA) to amplify PKD1 ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were resuspended in 50 μl of the following PCR master mix with indexed primers from the Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011): Phusion HF 2X (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Immunology 2019Quote: ... before tagmentation and PCR amplification with index primers using the Nextera XT DNA SMP Prep Kit and Nextera XT IDX Kit (Illumina, San Diego, CA). After cleanup with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2024Quote: ... and the final sequencing library was amplified utilizing the KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit along with index primers from the Nextera XT Index Kit (Illumina, FC-131-1001). The amplification protocol involved an initial step at 98°C for 45 seconds ...
-
bioRxiv - Immunology 2021Quote: ... and Nextera Indexing Primers (Illumina, Inc). A second size-selection was performed post-PCR to enrich for low molecular weight DNA ...
-
bioRxiv - Immunology 2021Quote: ... 2μL of 10μM RP1 primer (Illumina), 2μL of 10μM RPI library specific primer (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... 2μL of 10μM RP1 primer (Illumina), 2μL of 10μM RPI library specific primer (Illumina ...
-
bioRxiv - Developmental Biology 2019Quote: ... Buenrostro primers differ slightly from Illumina Nextera primers with the addition of 7 bp (Nextera Index Read 2 Primer/ Universal or i5 ...
-
bioRxiv - Microbiology 2019Quote: ... Paired-end index primers (Illumina Nextera) followed on a secondary PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The primers (with partial Illumina adapters) used were:
-
PD-1 checkpoint blockade disrupts CD4 T cell regulated adaptive B cell tolerance to foreign antigensbioRxiv - Immunology 2021Quote: ... 2μL of 10μM RP1 primer (Illumina), 2μL of 10μM RPI library specific primer (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... using TruSeq small RNA primers (Illumina) as previously described [23] ...
-
bioRxiv - Developmental Biology 2024Quote: ... with i7 primers from Illumina (N70X) together with a custom P5 primer (see Drop-seq protocol) ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sample indexes and P7 primers (Illumina) were ligated during library construction using the following PCR protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Genomics 2020Quote: ... 0.375 uM of the i5 primer (Microsynth AG) and 0.375 uM of the barcoded i7 primer (Illumina). PCR was performed using the following program ...
-
bioRxiv - Genetics 2022Quote: ... Individual sequencing barcodes were added to each sample by amplifying the 20 μL elution in a 50 μL Q5 NEBNext reaction with 0.5 uM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex) for sample demultiplexing post-sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with TruSeq® RNA Single Indexes Set A (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The Nextera XT Index Kit v2 Sets A-D (Illumina) barcodes were used for the amplified sequencing libraries and the quality of libraries was assessed using a Qubit fluorometer (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... using the Nextera XT Index Kit v2 set A (Illumina). DNA concentrations were quantified using a Qubit ...
-
bioRxiv - Microbiology 2023Quote: ... and TruSeq DNA Single Indexes Set A or B (Illumina), excluding the DNA fragmentation and clean-up of fragmented DNA steps ...
-
bioRxiv - Genomics 2023Quote: ... Illumina Nextera DNA Unique Dual Indexes Set C (Illumina, 20027215) were added and amplified (12 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... using the Nextera XT Index Kit v2 Set B (Illumina). Samples were normalized and pooled together using a combination of the Qubit (Thermo ...
-
bioRxiv - Microbiology 2019Quote: ... PCR mixtures for amplification contained (per 25 µl reaction): 0.5 µl of each primer (515F and 806R with Illumina tags; 10 µM stock concentration), 12.5 µl of 2x KAPA HiFi Hotstart Readymix (Kapa Biosystems ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We confirmed all strains had marker-less deletions by PCR followed by Sanger sequencing (primers given in Table S1) and Next Generation Sequencing (Illumina HiSeq PE150, >30x coverage). We used P1 transduction to transfer modifying enzyme (ME ...
-
bioRxiv - Pathology 2020Quote: The V3-V4 hypervariable regions of the 16S_rDNA were amplified by two steps PCR using v1 primers (Vaiomer) and sequenced using MiSeq Reagent Kit v3 (2×300 bp Paired-End Reads, Illumina, San Diego, CA, USA) as previously described [24] ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a custom sequencing primer (MAC-seq Read primer) and a High Output Kit v2.5 75 Cycles (Illumina) with paired-end configuration (25 base pairs for read 1 and 50 base pairs for read 2).
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...