Labshake search
Citations for Illumina :
1051 - 1100 of 9681 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and the TruSeq Stranded mRNA kit (Illumina) was used to prepare poly(A ...
-
bioRxiv - Developmental Biology 2019Quote: ... and TruSeq ChIP Sample Prep kit (Illumina) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... barcoded by using the Nextera kit (Illumina), and pooled in one lane of an Illumina HiSeq2500 for sequencing ...
-
bioRxiv - Genomics 2021Quote: ... using TruSeq SBS Kit v4 reagents (Illumina). The RNA-seq experiment was performed in two replicates for each sample distributed across 8 lanes ...
-
bioRxiv - Genomics 2021Quote: ... with a NextSeq High Output kit (Illumina) platform with 2 x 150 read length.
-
bioRxiv - Immunology 2021Quote: ... TruSeq stranded mRNA Library prep kit (Illumina) and Truseq RNA Unique Dual Indexed Adapters (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2021Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: The Nextera DNA Library Prep Kit (Illumina) was used to prepare sequence libraries with 25 ng of input DNA ...
-
bioRxiv - Genomics 2020Quote: ... RNA Library Prep Kit v2 from Illumina® (Illumina Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the TruSeq stranded mRNA kit (Illumina) to enrich for polyadenylated transcripts ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mid Output 150 cycles kits (Illumina®) for 2 × 75 bp PE reads ...
-
bioRxiv - Microbiology 2021Quote: ... the Ribo-Zero rRNA removal kit (Illumina) was used without deviations from the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using a MiSeq v3 Reagent Kit (Illumina) and 2 × 300 bp paired end sequencing ...
-
bioRxiv - Immunology 2021Quote: ... using the v3 MiSeq Reagent Kit (Illumina). 16S data were analyzed using QIIME 2 (3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... TruSeq SBS Kit v3-HS (Illumina, USA).
-
bioRxiv - Immunology 2020Quote: ... with the Ribo-Zero Gold kit (Illumina) for ribosomal depletion ...
-
bioRxiv - Immunology 2020Quote: ... employing Illumina MiSeq v2 Reagent Kit (Illumina). For the analysis of TCR sequencing data ...
-
bioRxiv - Immunology 2020Quote: ... Indices from the Nextera Index Kit (Illumina), followed by adaptors P1 (AATGATACGGCGACCACCGA ...
-
bioRxiv - Microbiology 2021Quote: ... with HiSeq Rapid SBS kit v2 (Illumina), generating paired-end reads up to 250 bp ...
-
bioRxiv - Genetics 2019Quote: ... and Index Kit (Illumina FC-131-1001), according to the standard manufacturer protocol ...
-
bioRxiv - Genomics 2021Quote: ... purified for library preparation (Illumina Library Kit), and deep-sequencing with 200 million tags through Illumina HiSeq2500 sequencer.
-
bioRxiv - Genomics 2021Quote: ... rRNA was depleted using RiboZero kit (Illumina). NGS-libraries were generated using NEBnext Ultra II directional RNA library prep kit for Illumina and sequenced as PE75 reads on an Illumina NextSeq550.
-
bioRxiv - Genomics 2021Quote: KAPA Hyper Prep Kits from Illumina (KK8500) were used to construct the library with a slight modification to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... using the TruSeq SBS Kit v3 (Illumina). An average of 40 million paired reads were generated per sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2.5μl Transposase enzyme (Illumina Nextera kit, 15028252) and 22.5μl Nuclease-free water in a total of 50uL reaction for 1 hour at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... TruSeq Stranded mRNA Library Prep kit (Illumina) was used to assess transcript abundance following standard instructions from the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The Kapa Hyper Prep kit (for Illumina) was used for sequencing library preparation ...
-
bioRxiv - Microbiology 2022Quote: ... Multiplexing Sample Preparation Oligonucleotide Kit from Illumina, Inc ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Nextera XT index kit D (Illumina). Amplicon sizes were verified on a Tapestation using the High Sensitivity D1000 Screentape (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Ribo-Zero rRNA removal kit (Illumina). After purifying RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... tagmentation (Nextera DNA Sample Preparation Kit, Illumina) and library preparation was performed ...
-
bioRxiv - Neuroscience 2022Quote: ... The TruSeq RNA Sample Prep Kit (Illumina) was used for library preparation from all samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100-500 ng of total RNA underwent polyA selection and TruSeq library preparation according to instructions provided by Illumina (TruSeq Stranded mRNA HT Kit, Illumina #20020595), with 15 cycles of PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 cycle sequencing kit v1.5 (Illumina Inc.). Basecalling was done by Illumina RTA3 and output was demultiplexed and converted to fastq format with bcl2fastq v1.9.0.
-
bioRxiv - Microbiology 2024Quote: ... The Nextera XT library construction kit (Illumina) was used to generate sequencing libraries following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2024Quote: ... The Nextera XT Index Kit v2 (Illumina) was used to add the dual-barcoded adaptors ...
-
bioRxiv - Developmental Biology 2023Quote: ... The Nextera DNA Library Preparation Kit (Illumina) was used to perform the transposition according to the manufacturer’s manual ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... TruSeq RNA Sample Preparation Kit v2 (Illumina) was used to prepare libraries for 100 bp paired-end RNA-seq ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and Nextera XT Index kit v2 (Illumina) were used to produce paired-end DNA libraries using half-volume reactions ...
-
bioRxiv - Genomics 2023Quote: ... 500 cycle kit (Illumina; San Diego, CA).
-
bioRxiv - Immunology 2023Quote: ... and Nextera XT library prep kit (Illumina) with an input of 10ng of RNA per sample ...
-
bioRxiv - Microbiology 2023Quote: ... using TruSeq SBS Kit v3 - HS (Illumina) for 50 cycles ...
-
bioRxiv - Genomics 2023Quote: The Nextera XT Index Kit (Illumina inc.) was used to construct the libraries ...
-
bioRxiv - Microbiology 2023Quote: ... using a MiSeq Reagent kit v3 (Illumina) following the standard guidelines for preparing and loading samples on the MiSeq ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified with a RiboZero kit (Illumina). The resulting mRNA fragment inserts were then reverse transcribed to first strand cDNA using reverse transcriptase and random primer in the presence of actinomycin D ...
-
bioRxiv - Molecular Biology 2023Quote: ... the TruSeq Small RNA Prep Kit (Illumina) was used to prepare small RNA libraries from RNA pyrophosphohydrolase (Rpph ...
-
bioRxiv - Microbiology 2023Quote: ... the TruSeq Stranded Library Preparation kit (Illumina) was used to prepare the sequencing library ...
-
bioRxiv - Microbiology 2023Quote: ... A TruSeq DNA Library Preparation Kit (Illumina) was used for cDNA library preparation ...