Labshake search
Citations for Bioline :
1 - 50 of 480 citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR reactions were performed with different sets of primers and Sensifast SYBR (Bioline, Taunton, MA) on a CFX96 or CFX384 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR reactions were set up in a 384-well format using 2X SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and 1 µl of cDNA per reaction in a total volume of 10 µl ...
-
bioRxiv - Cell Biology 2019Quote: ... The cDNA was then diluted 1:5 and qRT-PCR reactions were set up in triplicate using primers synthesized from IDT and SensiMix SYBR & Fluorescin kit (Bioline, Meridian Bioscience). qRT-PCR was done using a Corbett Research RG 6000 thermocycler ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR was carried out with specific primer sets (listed in Supplementary Table 10) using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, BIO-98005) and CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Systems Biology 2022Quote: ... followed by quantitative RT-PCR (RT-qPCR) using the SensiMix SYBR kit (Bioline). Expression analysis of genes of interest was performed on a Rotor-Gene Q (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... The MyTaq One-Step RT-PCR Kit (Bioline) was used to generate and amplify cDNA from viral RNA isolated from nasal wash samples (as above) ...
-
bioRxiv - Microbiology 2019Quote: ... One step RT-PCR was also performed to amplify viral RNA from the organs using MyTaq One-Step RT-PCR kit (Bioline, UK) for Sanger sequencing or deep sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-quantitative PCR (RT-qPCR) was performed using a SensiMix SYBR kit (Bioline, #QT605-05) on an Applied Biosystems ViiATM7 Real-Time PCR machine ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR reactions were set up using SensiFAST SYBR No-ROX kit (Bioline, BIO-98005) in a Light Cycler 480 II system (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... and RT-PCR performed using MyTaq DNA polymerase (Bioline). Fifty cycles of PCR were performed in order to identify low expressed transcripts ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ng/μl of total DNA was amplified using the primer sets in SensiFAST SYBR No-ROX (Bioline). qPCR was realized in technical duplicates in the Rotor-Gene Q real-time PCR cycler (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... obtained from the TaqMan RT-PCR kit (Bioline BIO-78005), was added to a 15 ml tube ...
-
bioRxiv - Immunology 2022Quote: ... obtained from the TaqMan RT-PCR kit (Bioline #BIO-78005), was added to a 15 ml tube ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR analysis was performed using Immolase DNA polymerase (Bioline) and fragments were separated on 2% argarose gels ...
-
bioRxiv - Immunology 2019Quote: ... Quantitative-PCR was set up using the SensiFAST SYBR Hi-ROX kit (Bioline) on a StepONE system (Applied Biosytems) ...
-
bioRxiv - Immunology 2021Quote: ... Real-time RT-PCR using SensiFast SYBR No-Rox kit (Bioline) was performed to determine gene expression ...
-
bioRxiv - Immunology 2021Quote: ... obtained from the TaqMan RT-PCR kit (Bioline cat# BIO-78005), RT ...
-
bioRxiv - Immunology 2022Quote: ... obtained from the TaqMan RT-PCR kit (Bioline cat# BIO-78005), was added to a 15 mL tube ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR and RT-qPCR were performed according to the manufacturer’s protocols using MyTaq™ Red Mix (Bioline/BIOCAT) for RT-PCR and GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR or RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Bioline) with gene-specific primers on a Applied Bioscience StepOnePlus qPCR machine (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time quantitative PCR (RT-qPCR) reactions were performed (Bioline #BIO-98020). NCBI primer BLAST software was used for oligonucleotide design (Ye et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The primers were tested with PCR using MyTaq DNA polymerase (Bioline, London, UK), with annealing temperature of 61 °C and an extension time of 30 s ...
-
bioRxiv - Microbiology 2019Quote: ... each PCR assay was set-up with nuclease-free water as the negative control (Bioline, UK), and positive controls were not included due to financial constraints ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR was performed using the SensiMix SYBR Low-ROX kit (Bioline) and a LightCycler® 480 (Roche) ...
-
bioRxiv - Immunology 2023Quote: RT-PCR was done using the RedTaq DNA Polymerase (Bioline, Memphis, TN, USA) following the recommended protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline) and gene-specific primers (Supplemental File S2) ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Molecular Biology 2020Quote: ... The purified PCR product was run on a 1% agarose gel cut out to remove remaining primer dimers and cleaned with PCR Isolate II PCR and Gel Kit (Bioline). The purified libraries were sequenced on an Illumina HiSeq2500 or MiSeq depending on the expected complexity of the library.
-
bioRxiv - Cancer Biology 2024Quote: ... and quantitative RT-PCR analyses were performed using SensiFAST™ SYBR® kit (Bioline) on an Applied Biosystems StepOne Plus instrument ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time RT–PCR (qRT–PCR) was carried out using the SensiFast™SYBR Hi-ROX One-Step Kit (Bioline) as described (Wobbe et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative RT-PCR analyses were performed using Brilliant III SYBR green QPCR master mix (Bioline) with gene-specific primers according to the manufacturer’s protocol and with the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR analyses were performed using Brilliant III SYBR Green QPCR master mix (Bioline) with gene-specific primers according to the manufacturer’s protocol and the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was performed using the SensiFASTTM Probe Lo-ROX One-Step kit (Bioline, UK). Primers and probe sequences ...
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was performed using the SensiFASTTM Probe Lo-ROX One-Step kit (Bioline, UK). Primers and probe sequences ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR reactions were carried out using SYBR Green (SensiMix SYBR Low-ROX Kit) (BIOLINE) on 7500 MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative-RT PCR was then performed using the SensiFAST SYBR Green Hi-ROX master mix (Bioline). Primers were designed (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using SensiMix SYBR Low-ROX Kit (Bioline; annealing temperature – 60°C) in a Lightcycler 480 384-well plate (Roche) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Expression levels of target genes were determined by RT-PCR using SensiMix SYBR No-Rox (Bioline) with the primers shown in Supplementary Table 1 ...
-
Local adaptation of Arabidopsis thaliana in a small geographic region with mild environmental clinesbioRxiv - Plant Biology 2023Quote: ... Reverse transcriptase quantitative PCR (RT-qPCR) reactions were performed with the SensiFast SYBR Green Mastermix (Bioline) on a Bio-RAD cfx96 machine ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time RT PCR was performed using the SensiFAST™ Probe Lo-ROX one-step kit (Bioline). In each reaction the primers final concentration was 600nM and the probe concentration was 300nM ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time RT-PCR was conducted with SensiFAST™ Probe Lo-ROX One-Step Kit (Bioline, 78005) and analyzed with the 7500 Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was carried out using the Bioline SensiFASTTM Probe Lo-ROX Kit (Bioline, Catalogue no.-84005) and Stratagene Mx3005P (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR reaction was setup using SensiFast Probe No-ROX One- Step Kit (Bioline, Cat. BIO-76005) using the following primers/probes ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was performed with the Bio-Rad CFX96 cycler using the SensiFAST™ SYBR® (Bioline). Gene expression for occludin (Ocln) ...
-
bioRxiv - Genomics 2020Quote: ... Realtime RT-PCR was carried out on an Applied Biosystems 7900HT using SensiMix SYBR green master mix (Bioline). 300nM each primer were added to 10μl reactions in 384-well plates ...
-
bioRxiv - Immunology 2021Quote: ... Real time quantitative PCR (RT-qPCR) analysis was carried out using the SensiMix SYBR No-Rox kit (Bioline), using primers and conditions shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time RT-PCR was performed using a SensiFastTM SYBR® Hi-ROX kit (#BIO-92020; Bioline USA Inc.) in an Applied Biosystems QuantStudio 7 Flex Real-Time PCR system (Thermo Fisher Scientific Inc.) ...
-
bioRxiv - Systems Biology 2023Quote: ... Each 20 µl RT reaction was amplified in a 100µl PCR reaction with MyTaq Red mix (#BIO-25043; Bioline). The second PCR reaction was performed using 10 µl of the product of the previous reaction in a 100 µl reaction using the same index variant primer and index variants of 437JvA (containing the S1 ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time RT-PCR was performed on 1:10 diluted cDNA using the SensiFAST SYBR No-ROX Kit (Bioline). Three biological and technical replicates were analyzed per genotype ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lyrata PER plants as above and a short section of ASY3 was PCR amplified using 0.5 μM primers (S5 Table) and MyTaq™ Red Mix (Bioline). PCR conditions were as follows ...