Labshake search
Citations for Bioline :
1 - 50 of 716 citations for Rat Protein SET SET ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR reactions were set up using sensiFAST SYBR Lo-ROX kit (Bioline). The qPCR was performed as described above for RIP-qPCR.
-
bioRxiv - Immunology 2019Quote: ... Quantitative-PCR was set up using the SensiFAST SYBR Hi-ROX kit (Bioline) on a StepONE system (Applied Biosytems) ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR reactions were set up using SensiFAST SYBR No-ROX kit (Bioline, BIO-98005) in a Light Cycler 480 II system (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... qPCR reactions were set up using SensiMix 2x Mastermix (Bioline Cat# QT615-20) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reactions were set up using SensiFast 2× Mastermix (Bioline Cat# BIO-94020) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... a 10 μl qPCR reaction is set up using SensiFAST SYBR No-ROX kit (FroggaBio/Bioline, catalogue number BIO-98050), forward and reverse primers (Table 2) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR reactions were set up in a 384-well format using 2X SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and 1 µl of cDNA per reaction in a total volume of 10 µl ...
-
bioRxiv - Cell Biology 2019Quote: ... The cDNA was then diluted 1:5 and qRT-PCR reactions were set up in triplicate using primers synthesized from IDT and SensiMix SYBR & Fluorescin kit (Bioline, Meridian Bioscience). qRT-PCR was done using a Corbett Research RG 6000 thermocycler ...
-
bioRxiv - Microbiology 2019Quote: ... each PCR assay was set-up with nuclease-free water as the negative control (Bioline, UK), and positive controls were not included due to financial constraints ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR was carried out with specific primer sets (listed in Supplementary Table 10) using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, BIO-98005) and CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR reactions were performed with different sets of primers and Sensifast SYBR (Bioline, Taunton, MA) on a CFX96 or CFX384 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ng/μl of total DNA was amplified using the primer sets in SensiFAST SYBR No-ROX (Bioline). qPCR was realized in technical duplicates in the Rotor-Gene Q real-time PCR cycler (Qiagen) ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Neuroscience 2022Quote: ... RNA was extracted using the ISOLATE II RNA/DNA/Protein kit (Bioline, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated using Bioline II DNA/RNA/Protein extraction kit (Bioline, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein overexpression was performed using Escherichia coli BL21 (DE3) pLysS cells (BIOLINE) in super broth supplemented with 200 μg/mL ampicillin (AMRESCO ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... SensiFAST cDNA Synthesis Kit and the SensiFAST SYBR Lo-ROX Kit (Bioline, NSW, Australia), respectively ...
-
bioRxiv - Immunology 2021Quote: ... Sensifast cDNA synthesis kit (Bioline) was used to transcribe total RNA to cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... No-ROX Kit (Bioline, USA), 150nM forward primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sensifast Hi-Rox SyBr kit (Bioline) was used to perform the RT-qPCR on a StepOnePlus system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and a SensiFast Probe kit (Bioline). Expression of tubulin was used to normalize the expression of target genes ...
-
bioRxiv - Plant Biology 2022Quote: ... and the qPCR SensiMix kit (BioLine, GC Biotech BV ...
-
bioRxiv - Physiology 2019Quote: ... SYBR® No-ROX Kit (Bioline) in an Applied Biosysems cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using SensiFAST cDNA Synthesis Kit (Bioline). The quality and concentration of template RNA and of cDNA were assessed with NanoDrop OneC Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline), respectively ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR® kit (Bioline) and primers specific for the membrane protein gene of HCoV-OC43 and HCoV-229E (Vijgen et al. ...
-
bioRxiv - Microbiology 2020Quote: PCR products were purified using a commercial kit (Isolate II PCR and Gel Kit, Bioline, London, UK) and sent for sequencing (Macrogen Europe ...
-
bioRxiv - Neuroscience 2021Quote: ... In short myTaq extract-PCR kit (Bioline) was used to amplify a 300 bp fraction of the ath5 gene containing the lakritz mutation using the following primers ...
-
bioRxiv - Microbiology 2019Quote: ... using the SensiFast SYBR-NoRox kit (Bioline) in quadruplicate for each gDNA sample using primers listed in Suppl ...
-
bioRxiv - Immunology 2019Quote: ... and SensiFAST SYBR Lo-Rox kit (BioLine) were used ...
-
bioRxiv - Developmental Biology 2019Quote: ... with SensiMix SYBR Hi-ROX Kit (Bioline) following manufactures instructions ...
-
bioRxiv - Genetics 2020Quote: ... SensiFAST SYBR No-ROX kit from Bioline, and a Biorad CFX Connect instrument ...
-
bioRxiv - Neuroscience 2021Quote: ... Bioline cDNA synthesis kit (Bioline, London, UK) was utilised to synthesize cDNA from 1 μg of total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... The SensiFAST SYBR Hi-ROX kit (Bioline) was used for qPCR reactions ...
-
bioRxiv - Microbiology 2021Quote: ... or SensiFAST SYBR Hi-ROX kit (Bioline). Reactions were run using Applied Biosystems 7500 fast RT-PCR machine (Thermofisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... The SensiMix SYBR Kit (Bioline, Taunton, USA) was used for qRT-PCR in a QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... with SensiFAST SYBR Lo-ROX Kit (Bioline). Cycling parameters were 95°C for 3 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... using SensiFAST SYBR No-ROX Kit (Bioline).
-
bioRxiv - Genetics 2020Quote: ... or MyTaq™ Extract-PCR Kit (Bioline). gDNA was prepared from blastocysts in a 20 µL solution of 185.5 mM pH 8.3 Tris-HCl ...
-
bioRxiv - Genomics 2021Quote: ... ans Isolate II Genomic DNA kit (Bioline) was used to extract genomic DNA from 1×107 cells ...
-
bioRxiv - Microbiology 2023Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using the SensiFAST SYBR & Fluorescein Kit (Bioline), on a Roche Lightcycler 96 ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR Lo-ROX kit (Bioline). Melt curve analysis was performed ...
-
bioRxiv - Plant Biology 2023Quote: ... using ISOLATE II RNA mini kit (Bioline). cDNA was synthetized from 1μg of RNA using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Pathology 2023Quote: ... using SensiFAST SYBR NO ROX kit (Bioline). Fluorescent dye intensity was analyzed and quantified with linear regression ...
-
bioRxiv - Microbiology 2023Quote: ... or Isolate II RNA mini kit (Bioline). DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ISOLATE II RNA Mini Kit (Bioline) was used to extract RNA from CRC patient samples following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: For quantification of cellular TMPRSS2 and GAPDH expression cDNA synthesis and qPCR were performed according to the manufacturer’s instructions using the SensiFast cDNA kit and SensiFAST SYBR qPCR kit (both from Bioline). The qPCR was run on a StepOnePlus realtime PCR cycler (Thermo ...