Labshake search
Citations for Bioline :
1 - 50 of 720 citations for Mouse Protein SET SET ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR reactions were set up using sensiFAST SYBR Lo-ROX kit (Bioline). The qPCR was performed as described above for RIP-qPCR.
-
bioRxiv - Immunology 2019Quote: ... Quantitative-PCR was set up using the SensiFAST SYBR Hi-ROX kit (Bioline) on a StepONE system (Applied Biosytems) ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR reactions were set up using SensiFAST SYBR No-ROX kit (Bioline, BIO-98005) in a Light Cycler 480 II system (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... qPCR reactions were set up using SensiMix 2x Mastermix (Bioline Cat# QT615-20) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reactions were set up using SensiFast 2× Mastermix (Bioline Cat# BIO-94020) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... a 10 μl qPCR reaction is set up using SensiFAST SYBR No-ROX kit (FroggaBio/Bioline, catalogue number BIO-98050), forward and reverse primers (Table 2) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR reactions were set up in a 384-well format using 2X SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and 1 µl of cDNA per reaction in a total volume of 10 µl ...
-
bioRxiv - Cell Biology 2019Quote: ... The cDNA was then diluted 1:5 and qRT-PCR reactions were set up in triplicate using primers synthesized from IDT and SensiMix SYBR & Fluorescin kit (Bioline, Meridian Bioscience). qRT-PCR was done using a Corbett Research RG 6000 thermocycler ...
-
bioRxiv - Microbiology 2019Quote: ... each PCR assay was set-up with nuclease-free water as the negative control (Bioline, UK), and positive controls were not included due to financial constraints ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR was carried out with specific primer sets (listed in Supplementary Table 10) using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, BIO-98005) and CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR reactions were performed with different sets of primers and Sensifast SYBR (Bioline, Taunton, MA) on a CFX96 or CFX384 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ng/μl of total DNA was amplified using the primer sets in SensiFAST SYBR No-ROX (Bioline). qPCR was realized in technical duplicates in the Rotor-Gene Q real-time PCR cycler (Qiagen) ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Neuroscience 2022Quote: ... RNA was extracted using the ISOLATE II RNA/DNA/Protein kit (Bioline, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated using Bioline II DNA/RNA/Protein extraction kit (Bioline, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA (gDNA) was isolated from mouse brains or dural meninges using the Isolate II Genomic DNA Kit (Bioline, BIO-52067) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Parasite genomic DNA was isolated from mouse peritoneal exudate cells and whole brain using the Isolate II Genomic DNA Kit (Bioline, BIO-52067). Prior to isolation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant proteins were produced in Escherichia coli BL21 (DE3) cells (Bioline) as described previously (LaCourse ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein overexpression was performed using Escherichia coli BL21 (DE3) pLysS cells (BIOLINE) in super broth supplemented with 200 μg/mL ampicillin (AMRESCO ...
-
bioRxiv - Microbiology 2019Quote: ... using the amplification kit SensiFAST SYBR No-Rox kit (Bioline, London, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... SensiFAST cDNA Synthesis Kit and the SensiFAST SYBR Lo-ROX Kit (Bioline, NSW, Australia), respectively ...
-
bioRxiv - Immunology 2021Quote: ... Sensifast cDNA synthesis kit (Bioline) was used to transcribe total RNA to cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... No-ROX Kit (Bioline, USA), 150nM forward primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sensifast Hi-Rox SyBr kit (Bioline) was used to perform the RT-qPCR on a StepOnePlus system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and a SensiFast Probe kit (Bioline). Expression of tubulin was used to normalize the expression of target genes ...
-
bioRxiv - Plant Biology 2022Quote: ... and the qPCR SensiMix kit (BioLine, GC Biotech BV ...
-
bioRxiv - Physiology 2019Quote: ... SYBR® No-ROX Kit (Bioline) in an Applied Biosysems cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using SensiFAST cDNA Synthesis Kit (Bioline). The quality and concentration of template RNA and of cDNA were assessed with NanoDrop OneC Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline), respectively ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR® kit (Bioline) and primers specific for the membrane protein gene of HCoV-OC43 and HCoV-229E (Vijgen et al. ...
-
bioRxiv - Immunology 2024Quote: Total RNA was isolated from mouse tissues using TRIsure reagent (BIO-38033, Bioline Gmbh, Germany) and genomic DNA was digested using RNase-free DNase (rDNase ...
-
bioRxiv - Microbiology 2020Quote: PCR products were purified using a commercial kit (Isolate II PCR and Gel Kit, Bioline, London, UK) and sent for sequencing (Macrogen Europe ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of SFB in fecal mouse content was performed using the MasterMix SensiFAST™ SYBR (BIOLINE) and specific primer pair for_5‘-GACGCTGAGGCATGAGAGCAT-3‘ ...
-
bioRxiv - Neuroscience 2021Quote: ... In short myTaq extract-PCR kit (Bioline) was used to amplify a 300 bp fraction of the ath5 gene containing the lakritz mutation using the following primers ...
-
bioRxiv - Microbiology 2019Quote: ... using the SensiFast SYBR-NoRox kit (Bioline) in quadruplicate for each gDNA sample using primers listed in Suppl ...
-
bioRxiv - Immunology 2019Quote: ... and SensiFAST SYBR Lo-Rox kit (BioLine) were used ...
-
bioRxiv - Developmental Biology 2019Quote: ... with SensiMix SYBR Hi-ROX Kit (Bioline) following manufactures instructions ...
-
bioRxiv - Genetics 2020Quote: ... SensiFAST SYBR No-ROX kit from Bioline, and a Biorad CFX Connect instrument ...
-
bioRxiv - Neuroscience 2021Quote: ... Bioline cDNA synthesis kit (Bioline, London, UK) was utilised to synthesize cDNA from 1 μg of total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... The SensiFAST SYBR Hi-ROX kit (Bioline) was used for qPCR reactions ...
-
bioRxiv - Microbiology 2021Quote: ... or SensiFAST SYBR Hi-ROX kit (Bioline). Reactions were run using Applied Biosystems 7500 fast RT-PCR machine (Thermofisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... The SensiMix SYBR Kit (Bioline, Taunton, USA) was used for qRT-PCR in a QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... with SensiFAST SYBR Lo-ROX Kit (Bioline). Cycling parameters were 95°C for 3 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... using SensiFAST SYBR No-ROX Kit (Bioline).
-
bioRxiv - Genetics 2020Quote: ... or MyTaq™ Extract-PCR Kit (Bioline). gDNA was prepared from blastocysts in a 20 µL solution of 185.5 mM pH 8.3 Tris-HCl ...
-
bioRxiv - Genomics 2021Quote: ... ans Isolate II Genomic DNA kit (Bioline) was used to extract genomic DNA from 1×107 cells ...
-
bioRxiv - Microbiology 2023Quote: ... and SensiFAST cDNA Synthesis Kit (Bioline, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR Lo-ROX kit (Bioline). Melt curve analysis was performed ...
-
bioRxiv - Pathology 2023Quote: ... using SensiFAST SYBR NO ROX kit (Bioline). Fluorescent dye intensity was analyzed and quantified with linear regression ...
-
bioRxiv - Plant Biology 2023Quote: ... using ISOLATE II RNA mini kit (Bioline). cDNA was synthetized from 1μg of RNA using SensiFAST cDNA Synthesis kit (Bioline) ...