Labshake search
Citations for Bioline :
1 - 9 of 9 citations for 7 ACT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: PCR for cloning purposes was performed using the proofreading Bio-X-ACT (Bioline) enzyme ...
-
bioRxiv - Zoology 2022Quote: ... 0.5 μl BIO-X-ACT short DNA polymerase (Bioline Reagents Ltd, London, UK), 35.4 μl ddH2O ...
-
bioRxiv - Microbiology 2023Quote: PCR for cloning purposes was performed using the proofreading Bio-X-ACT (Bioline) or Phusion (NEB ...
-
bioRxiv - Plant Biology 2022Quote: ... and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC) and CUE8cDNA-STOP-R (AGAGACTCAAGACACAGCAGGA) using BIO-X-ACT Long DNA polymerase (Bioline, London, UK). The 2622 bp product was directionally cloned by ligation into the pENTR/D-TOPO vector (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplification of each gene was performed in a 25-µL reaction mix using the Bio-X-Act short polymerase mix (Bioline, London, UK), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Immunology 2022Quote: ... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
bioRxiv - Biophysics 2021Quote: Genotyping of ClC-7 KO U2OS clone was performed using an Extract PCR-Kit (Bioline) with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μL of SensiMix™ SYBR® Green Master Mix (Bioline®, Memphis, TE, USA), and H20 in a total volume of 15 μL ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...