Labshake search
Citations for GE Life Sciences :
1 - 50 of 721 citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Whole blood was collected 25 to 39 days following a positive RT-PCR test and subjected to density gradient centrifugation using the Ficoll Paque Plus reagent (GE Healthcare, #17-1440-02). After separation ...
-
bioRxiv - Immunology 2020Quote: ... Whole blood was collected 31 and 32 days following a positive RT-PCR test and subjected to density gradient centrifugation using the Ficoll Paque Plus reagent (GE Healthcare, #17-1440-02). After separation ...
-
bioRxiv - Physiology 2019Quote: ... with 100nM miR scrambled or miR-181a mimic (100nM; GE Healthcare) (Soriano-Arroquia et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the PCR reaction was mixed with streptavidin beads (GE Healthcare #17-5113-01) and binding buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... G sepharose (17-1279-03 and 17-0618-05, GE Healthcare) at 4°C on a nutator ...
-
bioRxiv - Molecular Biology 2021Quote: ... G sepharose (17-1279-03 and 17-0618-05, GE Healthcare) at 4°C with agitation ...
-
bioRxiv - Genomics 2021Quote: ... G sepharose (17-1279-03 and 17-0618-05, GE Healthcare) at 4°C with agitation ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of the PCR reaction was mixed with streptavidin beads (GE Healthcare #17-5113-01) by shaking for 5 minutes at room temperature and ...
-
bioRxiv - Developmental Biology 2020Quote: ... Biotinylated PCR products (20μL) were immobilized on Streptavidin-coated Sepharose beads (GE Healthcare, 17-5113-01). DNA strands were separated using the PyroMark Q24 Vacuum Workstation ...
-
bioRxiv - Immunology 2022Quote: ... and resuspended in 24 mL of RT 70% PercollTM (1.088 g/mL at 22 °C; GE Healthcare Life Sciences 17-0891-01). Aliquots of 8 mL cell/PercollTM suspension were overlayed with 4 mL HBSS and centrifuged at 400 xg for 30 minutes RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... was purchased from VWR (GE Healthcare 17-5113-01). OMIX C18 tips (100 µL ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Genomics 2021Quote: ... #S0282).[1] Reverse transcription was performed in 1.5 mL microfuge tubes under end-over-end rotation using a modified Reverse Transcription mix (1x Maxima H-RT buffer, 4% Ficoll PM-400 (GE Healthcare, #17-0300-05), 3 mM MgCl2 (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was generated using Illustra RT-PCR ready-to-go beads (GE Healthcare) in a two-step reaction ...
-
bioRxiv - Neuroscience 2020Quote: ... Sepharose (GE Healthcare, 17-0618-01) for 2 h at 4°C rotating ...
-
bioRxiv - Molecular Biology 2023Quote: ... the corresponding ORF regions were PCR-amplified from the parent plasmid pcDNA3-Flag-RBM17 with specific primer sets (Supplementary Table S2) and subcloned into the pGEX6p2 vector (GE Healthcare Life Sciences). To construct the series of SAP30BP and SAP30 expression plasmids (pcDNA3-Myc-SAP30BP ...
-
bioRxiv - Molecular Biology 2023Quote: ... the corresponding ORF regions were PCR-amplified from HeLa cells cDNA with specific primer sets (Supplementary Table S2) and subcloned into the pcDNA3-Myc or pGEX6p2 vectors (GE Healthcare Life Sciences). Overlap extension PCR was performed to induce the mutation in the ULM of pcDNA3-Myc-SAP30BP (pGEX6p2-SAP30BP/ULMmt).
-
bioRxiv - Plant Biology 2021Quote: ... nested PCR was performed using primers listed in Supporting Information Table S1 and Ready-ToGo beads (illustra PuReTaq PCR Beads, GE Healthcare). In the first round ...
-
bioRxiv - Molecular Biology 2024Quote: ... 30 μl of a protein A/G sepharose mixture (GE Healthcare; #17-0780-01 and #17-0618-01), pre-equilibrated in ChIP dilution buffer was added to the lysates and incubation continued for 2 h at 4°C ...
-
bioRxiv - Biophysics 2019Quote: ... Q column (GE Healthcare, 17-5156-01) was used to purify the protein samples and size-exclusion chromatography Superdex 75 (GE Healthcare ...
-
bioRxiv - Plant Biology 2020Quote: ... Percoll® (#17-0891-02, GE Healthcare) gradients were prepared as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... and PD10 (GE Healthcare, 17-0851-01) exchange columns ...
-
bioRxiv - Immunology 2020Quote: Ficoll-Hypaque (GE Healthcare, 17-1440-03) and cultured (2×106 cells/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... the percoll (#17-0891-01, GE healthcare) gradient was prepared using ADS buffer ...
-
bioRxiv - Genomics 2021Quote: ... After capillary transfer in 10× SSC onto a Hybond N+ membrane (GE Healthcare), RNA was UV-crosslinked and stained with methylene blue to visualise ribosomal RNA bands ...
-
bioRxiv - Bioengineering 2021Quote: ... Protein G-coupled sepharose (#17–0618–01) and Protein A-coupled sepharose (#17–5138–01) beads were from GE Healthcare and the protease inhibitor cocktail was from Sigma.
-
bioRxiv - Cell Biology 2021Quote: ... Protein G–Sepharose (GE Healthcare, 17-0618-01). Dynabeads Protein G (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... SP Sepharose beads (#17-0729-01, GE Healthcare) were equilibrated with the lysis buffer and the cleared lysate obtained is mixed with the beads and batch bound for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 23% Percoll (GE Healthcare, #17-0891-01) layers (6 mL/layer ...
-
bioRxiv - Cell Biology 2020Quote: ... Ficoll PM400 (GE Healthcare, Cat. #17-0310-10) or polyethylene glycol 4000 (PEG ...
-
bioRxiv - Immunology 2021Quote: ... Ficoll Paque Plus (GE Healthcare, 17-1440-02) was used for peripheral blood mononuclear cells (PBMC ...
-
bioRxiv - Cell Biology 2021Quote: ... and PD-10 (GE Healthcare, 17-0851-01) desalting columns ...
-
Improved Activity and Kinetics of Endoglucanase Biofuel Enzyme with Addition of an AzoTAB SurfactantbioRxiv - Bioengineering 2023Quote: ... HiTrap Phenyl HP (GE Healthcare, 17-1351-01) hydrophobic column was used to obtain β-glucosidase fraction ...
-
bioRxiv - Cell Biology 2023Quote: ... Ficoll®70 (GE Healthcare 17-0310-10), guar (Fluka 09999) ...
-
bioRxiv - Cell Biology 2023Quote: ... Ficoll®400 (GE Healthcare 17-0300-10), Ficoll®70 (GE Healthcare 17-0310-10) ...
-
bioRxiv - Genomics 2024Quote: ... Ficoll-Paque Plus (GE Healthcare, 17-1440-02) was used for PBMC separation ...
-
bioRxiv - Neuroscience 2023Quote: ... The total volumes of soluble brain extracts were separated by SEC as previously described [17] on a single Superdex200 10/300GL column (no. 17-5175-01, GE Healthcare) in PBS (no ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... sections were washed in 4X SSC and RNA digested with RNase A (GE Healthcare) at 0.02 mg⁄mL in an appropriate buffer (0.5M NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Chromatin-IgG complexes were pull down using protein A/G sepharose beads (GE Healthcare; Cat #17-0618-01 and #17-0780-01) for 2h rocking at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... a 40% Percoll gradient (GE Healthcare, 17-0891-01) was used to remove myelin and other debris from the samples ...
-
bioRxiv - Immunology 2022Quote: Percoll (17-0891-02) was purchased from GE Healthcare Life Sciences ...
-
bioRxiv - Molecular Biology 2022Quote: ... Commercial IgG Sepharose Beads (GE Healthcare, 17-0969-01) were used in order to immunoprecipitate TAP-tagged proteins.
-
bioRxiv - Immunology 2020Quote: ... Ficoll® Paque Plus (GE Healthcare, 17-1440-02) was used for peripheral blood mononuclear cells (PBMC ...
-
bioRxiv - Biochemistry 2019Quote: ... A Histrap HP column (GE Healthcare, 17-5248-02) was used to purify the proteins from the lysates ...
-
bioRxiv - Immunology 2020Quote: ... Percoll (#17-0891-01) was purchased from GE Healthcare. LPS (ALX-581-008-L001 ...
-
bioRxiv - Genomics 2021Quote: ... supplemented with 17% FBS (Hyclone™, SV30160.03, GE Healthcare), 2 mM GlutaMAX™ (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein G Sepharose beads (17-0618-02, GE Healthcare) was used to recover the targeted chromatin ...
-
bioRxiv - Molecular Biology 2021Quote: ... Glutathione Sepharose™ 4B (GE healthcare; catalog no. 17-0756), equilibrated to the GST lysis buffer (50 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2019Quote: ... 6% Ficoll PM-400 (17-0300-10, GE Healthcare, Sweden), 0.2% sarcosyl (L7414 ...
-
bioRxiv - Immunology 2020Quote: ... Elution from HisTrap columns (GE Life Sciences # 17-3712-05) was accomplished using 0.5 M imidazole and fractionated into 1 ml aliquots using the Frac30 fraction collector (GE Life Sciences # 29023051) ...