Labshake search
Citations for GE Life Sciences :
1 - 50 of 271 citations for hsa mir 222 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... with 100nM miR scrambled or miR-181a mimic (100nM; GE Healthcare) (Soriano-Arroquia et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with 20nM siRNA against hsa-CHST15_0003 or hsa-TNFRSF21_0001 or a non-targeting siRNA control (GE Healthcare Dharmacon, Inc., Lafayette, CO, USA) using Lipofectamine 3000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was generated using Illustra RT-PCR ready-to-go beads (GE Healthcare) in a two-step reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... the corresponding ORF regions were PCR-amplified from the parent plasmid pcDNA3-Flag-RBM17 with specific primer sets (Supplementary Table S2) and subcloned into the pGEX6p2 vector (GE Healthcare Life Sciences). To construct the series of SAP30BP and SAP30 expression plasmids (pcDNA3-Myc-SAP30BP ...
-
bioRxiv - Molecular Biology 2023Quote: ... the corresponding ORF regions were PCR-amplified from HeLa cells cDNA with specific primer sets (Supplementary Table S2) and subcloned into the pcDNA3-Myc or pGEX6p2 vectors (GE Healthcare Life Sciences). Overlap extension PCR was performed to induce the mutation in the ULM of pcDNA3-Myc-SAP30BP (pGEX6p2-SAP30BP/ULMmt).
-
bioRxiv - Plant Biology 2021Quote: ... nested PCR was performed using primers listed in Supporting Information Table S1 and Ready-ToGo beads (illustra PuReTaq PCR Beads, GE Healthcare). In the first round ...
-
bioRxiv - Molecular Biology 2022Quote: cDNAs were PCR-amplified using corresponding primers (Supplementary Table S3) and cloned into a modified pGEX4T1 vector (GE Healthcare) encoding the TEV protease cleavage site after GST and into the vector derived from pACYC and pET28a(+ ...
-
bioRxiv - Plant Biology 2023Quote: ... The DNase I-treated RNAs were reverse transcribed using Ready-to-Go RT-PCR beads (GE Healthcare Life Science) and random oligomers ...
-
bioRxiv - Plant Biology 2023Quote: ... first-strand cDNA was synthesized from 2 µg of total RNA using Ready-to-Go RT-PCR beads (GE healthcare) and an oligo(dT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F1/R1 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and cloned into pJET1.2/blunt cloning vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F2/R2 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and directly sequenced.
-
bioRxiv - Microbiology 2020Quote: ... The molecular weight of AmvR in solution was estimated by comparing its elution volume to those of a set of molecular weight standards (HMW and LMW calibration sets, GE Healthcare).
-
bioRxiv - Plant Biology 2024Quote: ... the first cDNA strand was generated from 1 µg of the RNA using Ready-to-Go RT-PCR beads (GE Healthcare) and random oligomers ...
-
bioRxiv - Genomics 2021Quote: ... coupling the resulting probe set to Cy3 (GE Healthcare), Alexa Fluor 594 (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... The data sets were deconvolved with softWoRx (Applied Precision). 3D data sets were converted to Quick Projections in softWoRx. ...
-
bioRxiv - Cell Biology 2020Quote: ... Deconvolution microscopy (DeltaVision RT; Applied Precision) was performed using a 100x 1.40 NA Plan Apo objective and filter set (Sedat Quad ...
-
bioRxiv - Immunology 2021Quote: ... Whole blood was collected 25 to 39 days following a positive RT-PCR test and subjected to density gradient centrifugation using the Ficoll Paque Plus reagent (GE Healthcare, #17-1440-02). After separation ...
-
bioRxiv - Microbiology 2020Quote: ... the cDNA obtained in the section “Realtime and Endpoint RT-PCR detection of deltaviruses from animal specimens” was amplified using illustra GenomiPhi V2 Kit (GE healthcare; Chicago, IL, USA). The amplified DNA was then purified with innuPREP PCRpure Kit (Analytik Jena ...
-
bioRxiv - Immunology 2020Quote: ... Whole blood was collected 31 and 32 days following a positive RT-PCR test and subjected to density gradient centrifugation using the Ficoll Paque Plus reagent (GE Healthcare, #17-1440-02). After separation ...
-
bioRxiv - Cancer Biology 2020Quote: ... set up in an AKTA start system (GE Healthcare Life Science) and eluted as 1 ml fractions in PBS (Gibco® ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3’-primary amino-modified miR-430 MO (5’-TCTACCCCAACTTGATAGCACTTTC-3’) was obtained from Gene tools LLC and labeled with Cy3 NHS-ester (GE Healthcare). After the conjugation for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... All images were acquired by using the Deltavision set-up (GE Healthcare) with an inverted Olympus IX71 microscope ...
-
bioRxiv - Neuroscience 2020Quote: ... a PCR product of the intracellular domain flanked by BamHI and XhoI restriction sites was created from the equivalent full-length construct (forward primer catcatggatcctacaagcgggaccggcgcc; reverse primer catcatctcgagctatacccgagtggtggagtg) and subcloned into pGEX4T3 (GE Healthcare). GFP-tagged Gephyrin-FingR was a gift from Don Arnold (Addgene plasmid #46296 (Gross et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare), Alexa Fluor 594 (Life Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was performed on an Äkta primer (GE Healthcare) using a gradient from 0-100% Ni-elution buffer (50mM Tris pH 7.5 ...
-
bioRxiv - Microbiology 2019Quote: Human Custom ON-TARGET plus siKSRP or mimic miRs were resuspended in siRNA dilution buffer (Dharmacon, GE Healthcare, Chalfont-St-Giles, United Kingdom) to a 20 µM stock solution ...
-
bioRxiv - Cell Biology 2021Quote: A DeltaVision RT system (Applied precision, Olympus IX71 based) equipped with the Photometrics CoolSnap HQ camera (Roper Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... both sets of reactions were purified using Microspin Illustra G-25 columns (GE Healthcare) and Zeba spin desalting columns (7K MWCO ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were developed using ECL primer solution (GE healthcare RPN2236). The primary antibodies used in this study are the followings ...
-
bioRxiv - Cancer Biology 2019Quote: ... Images were acquired on a DeltaVision RT system (Applied Precision) with a ×100/1.40NA UPlanSApo objective (Olympus ...
-
bioRxiv - Microbiology 2019Quote: ... on a DeltaVision®RT microscope (Applied Precision, Washington, USA) as described by Domínguez-Cuevas et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... Images were acquired on a DeltaVision RT system (Applied Precision) with a ×100/1.40NA UPlanSApo objective (Olympus ...
-
bioRxiv - Cell Biology 2020Quote: ... a set of ON-TARGET human siRNAs against Arp3 (J-012077-08, Dharmacon, GE Healthcare), Myh9 (J-007668-07 ...
-
bioRxiv - Systems Biology 2020Quote: ... we pooled their complementary oligos and coupled the probe set to either Cy3 (GE Healthcare), Alexa Fluor 594 (Life Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... The column was calibrated using a set of gel filtration markers (low range, GE Healthcare), including Ovalbumin (43.0 kDa) ...
-
bioRxiv - Genomics 2021Quote: ... two sets of 20 µL of Protein A or Protein G Sepharose beads (GE Healthcare) were washed three times with nuclear lysis buffer for immunoprecipitation with antibody raised in guinea pig or in rabbit respectively ...
-
bioRxiv - Systems Biology 2021Quote: ... We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare), Alexa Fluor 594 (Life Technologies ...
-
bioRxiv - Systems Biology 2023Quote: ... We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare), Alexa Fluor 594 (Life Technologies ...
-
bioRxiv - Bioengineering 2023Quote: ... We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare), Alexa Fluor 594 (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... Chemiluminescence detection was achieved using ECL Primer reagents (GE Healthcare, UK).
-
bioRxiv - Physiology 2019Quote: ... mice were injected with 2mg/kg body weight three times during 4-week period with miR-181a mimic (GE Healthcare, C-310435-05 conjugated to cholesterol) or custom antagomiR-181a (5’-FITC-mA*mC*mUmCmAmCmCmGmAmCmAmGmCmGmUmUmGmAmA*mT*mG*mU*mU - 3’Cholesterol ...
-
bioRxiv - Biochemistry 2023Quote: ... gels were scanned with a Cy5 filter set on a Typhoon flatbed laser scanner (GE Healthcare). Spleens were similarly analysed with LE28 to confirm loss of activity in Lgmn-/- tissue ...
-
bioRxiv - Biochemistry 2022Quote: SPR experiments were performed at RT using BIACORE 3000 (GE Healthcare) instrument ...
-
bioRxiv - Molecular Biology 2023Quote: ... The coverslips were observed with a DeltaVision RT system (Applied Precision) controlling an interline charge-coupled device camera (Coolsnap ...
-
bioRxiv - Genetics 2019Quote: ... PCR reactions were performed with RTG PCR beads (GE Healthcare) in 25 μL final volume ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry filter sets and a CoolSNAP HQ2 camera (Roper Scientific) under the control of SoftWorx (Applied Precision). 37°C and 5% CO2 were maintained in a TOKAI Hit stage incubator ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry filter sets and a CoolSNAP HQ2 camera (Roper Scientific) under the control of SoftWorx (Applied Precision). Live cells were imaged using an Olympus 40x UPlanFL N Oil NA1.3 objective in imaging medium (Leibovitz’s L-15 medium (Gibco™ 21083027 ...
-
bioRxiv - Biochemistry 2019Quote: ... Clarified lysate was filtered through three sets of filters with decreasing pore size: 1.2 µm (GE Healthcare), 0.8 µm (GE-Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... Sections were imaged in a Deltavision RT widefield FM (GE Healthcare, U.S.A.) equipped with a Cascade II EM-CCD camera (Photometrics ...