Labshake search
Citations for GE Life Sciences :
1 - 50 of 1176 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... using buffer B (GE Healthcare Biosciences) and a flow rate of 1 mL/min ...
-
bioRxiv - Biochemistry 2022Quote: ... Superose 6 (10/300) column (#17-5172-01) and Superdex 200 increase 3.2/300 column (#28-9909-46) from GE Healthcare; Trans-blot turbo transfer pack (#1704158 ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.15 M NaCl and 0.05% Tween 20 (TNT) at 46 °C for 1 h followed by a streptavidin-Cy5 (GE Healthcare) detection step ...
-
bioRxiv - Immunology 2023Quote: ... from which the debris and the dead cells were removed by density gradient centrifugation with a 46% Percoll (GE Healthcare) gradient ...
-
bioRxiv - Biochemistry 2023Quote: ... YrbE1A/B-MceG and YrbE1A/B-MceGK43A were further purified and analyzed by SEC (AKTA, GE Healthcare) at 4 ⁰C on a pre-packed Superdex Increase 200 10/300 GL column (Cytiva) ...
-
bioRxiv - Biophysics 2023Quote: Proof-of-concept data were acquired in six healthy volunteers (five female, mean age 30 years, range 24 – 46 years) on a simultaneous 3T SIGNA PET-MR scanner (GE Healthcare); ethics approval was granted by the University of Manchester Research Ethics Committee (reference ...
-
bioRxiv - Biophysics 2020Quote: ... 25 µg/mL amphotericin B (GE Healthcare) and maintained at 26°C in non-vented ...
-
bioRxiv - Biophysics 2020Quote: ... 25 µg/mL amphotericin B (GE Healthcare) and maintained at 26°C in non-vented ...
-
bioRxiv - Biochemistry 2021Quote: ... SEC61A1 siRNA (Sec61α-kd, GE Healthcare, sequence AACACUGAAAUGUCUACGUUUUU), MMGT1 siRNA (EMC5-kd ...
-
bioRxiv - Developmental Biology 2019Quote: ... Murine MRTFA coding sequence was acquired from GE Healthcare Dharmacon (MMM1013-202859509) ...
-
bioRxiv - Biophysics 2023Quote: ... The reaction mixture was then purified using size-exclusion chromatography in HBS with a Superdex 200 Increase 3.2/300 column (GE Healthcare, 28-9909-46) to remove excess sortase A and undesired reaction byproducts ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mL fractions corresponding to ∼10 mL of the elution peak were pooled and applied to a 1 mL StrepTrap column (GE Healthcare, #28-9075-46) pre-equilibrated with Buffer N with 2 mM DTT ...
-
bioRxiv - Molecular Biology 2019Quote: ... or Ni-NTA-Agarose (GE healthcare, His-B-MYB). Lysates of HeLa cells expressing HA-tagged B-MYB constructs were incubated with 5 mg immobilized GST or GST-WW1/2-YAP for 3 hours at 4°C ...
-
bioRxiv - Systems Biology 2023Quote: ... Sera-Mag Speed Beads A and B (Ge Healthcare) were vortexed until the pellet was dissolved ...
-
bioRxiv - Molecular Biology 2019Quote: ... the GST sequence from the pGEX-6P plasmid (GE Healthcare) was amplified using primers 5’-GGCAGCAGCCATCATCATCATCATC ACAGCAGCGGCCTGATGTCCCCTATACTAGGTTATTGG-3’ and 5’-TCTTCTTTTGGAACCCA TCATATGGCTGCCGCGCGGCACGGGCCCCTGGAACAGA-3’ ...
-
bioRxiv - Genetics 2022Quote: ... Sequence products were purified on Sephadex G50 beads (GE Healthcare) and directly loaded onto 3130xl Genetic Analyzer capillary electrophoresis laser coupled system (ABI PRISM).
-
bioRxiv - Systems Biology 2022Quote: ... the coding sequence for this kinase (GE Healthcare Dharmacon: MHS6278-202756930) and its binding partner TAB1 (GE Healthcare Dharmacon ...
-
bioRxiv - Molecular Biology 2021Quote: ... ActiCHO Feed A and ActiCHO Feed B (both GE Healthcare) started on day four based on a glucose-controlled feeding regimen ...
-
bioRxiv - Biochemistry 2023Quote: ... whilst antigen-B was purified with rProteinA Sepharose (GE Healthcare). Affinity tags were cleaved by incubation with either thrombin (Merck ...
-
bioRxiv - Cell Biology 2019Quote: ... coli GST sequence on the pGEX-2T plasmid (GE Healthcare, Freiburg, Germany) using BamHI and EcoRI restriction sites ...
-
bioRxiv - Cell Biology 2019Quote: ... coli GST sequence on the pGEX-2T plasmid (GE Healthcare, Freiburg, Germany) using BamHI and EcoRI restriction sites ...
-
bioRxiv - Cell Biology 2019Quote: ... Sigma-Aldrich) (RNA oligos sequence for MIS12 is for GACGUUGACUUUCUUUGAU; GE Healthcare Dharmacon). To generate mitotic populations for immunoprecipitation experiments after EP ...
-
bioRxiv - Cancer Biology 2020Quote: The full-length GATA3 and CRLF2 coding sequence were purchased from GE Healthcare and cloned into the cL20c-IRES-GFP lentiviral vector ...
-
bioRxiv - Biochemistry 2023Quote: ... The amplified sequence was ligated into the pGEX-6P-1 vector (GE Healthcare) upon cleavage with the restriction enzymes BamHI and XhoI ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant G6b-B proteins were immobilized on CM5 sensor chips (GE Healthcare) via an Fc antibody using the Human Antibody Capture Kit (GE Healthcare) ...
-
bioRxiv - Biochemistry 2023Quote: ... Antigen B was further purified from Fc using rProteinA Sepharose (GE Healthcare), followed by deglycosylation with endoH (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: The sequence of Schistosoma japonicum GST was amplified from pGEX-4T-1 (GE Healthcare)
-
bioRxiv - Molecular Biology 2022Quote: ... it was applied to a Con A-Sepharose 4 B column (GE Healthcare), and glycoproteins were eluted with 0.5 M α-D-methylglucoside ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mM b-ME) and purified over a Superdex 200 column (GE Healthcare). Octamer-containing fractions were pooled according to purity and histone stoichiometry ...
-
bioRxiv - Molecular Biology 2022Quote: ... Real-time B-mode ultrasonography (NextGen LOGIQe R8, GE Healthcare, Chicago, IL, USA) and a multi-frequency linear-array transducer (L4-12T ...
-
Physiological Substrates and Ontogeny-Specific Expression of the Ubiquitin Ligases MARCH1 and MARCH8bioRxiv - Immunology 2021Quote: B cells were purified from spleens using Ficoll® Paque Plus (GE Healthcare) gradient centrifugation and negative depletion with FITC-conjugated mAb specific for CD4 (GK1.5) ...
-
bioRxiv - Molecular Biology 2023Quote: ... real-time B-mode ultrasonography (NextGen LOGIQe R8, GE Healthcare, Chicago, IL, USA) was used to determine the thickness of the VL of the right leg as previously described by our laboratory (18 ...
-
bioRxiv - Physiology 2023Quote: ... real-time B-mode ultrasonography (NextGen LOGIQe R8, GE Healthcare; Chicago, IL, USA) using a multifrequency linear-array transducer (L4-12T ...
-
bioRxiv - Physiology 2023Quote: ... real-time B-mode ultrasonography (NextGen LOGIQe R8, GE Healthcare; Chicago, IL, USA) using a multifrequency linear-array transducer (L4-12T ...
-
bioRxiv - Neuroscience 2023Quote: ... and were purified b y a ffinity ch romatography (GE Healthcare, Chicago, USA). Viral titer was determined by quantitative PCR using Taq-Man technology (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: A full-length zebrafish calaxin sequence was subcloned into pGEX-6P-2 vector (GE Healthcare). For the mEGFP-Calaxin protein ...
-
bioRxiv - Microbiology 2021Quote: Further purification of gyrase A and gyrase B used a mono-Q (GE Healthcare) column in buffer D and a linear gradient elution from 0 to 1 M NaCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Addition of nutrient feeds ActiCHO Feed A and ActiCHO Feed B (both GE Healthcare) started when glucose levels dropped below ≤ 4 g x L-1 and was continued daily thereafter ...
-
bioRxiv - Cell Biology 2020Quote: Coding sequences were amplified from plasmids encoding mouse GPR161 (BC028163; Mammalian Gene Collection [MGC]; GE Healthcare), mouse SSTR3 (gift from Kirk Mykytyn ...
-
bioRxiv - Immunology 2020Quote: PBMCs from Donors A and B were isolated by Ficoll-Paque (GE Healthcare, Pittsburgh, PA) gradient centrifugation and cryopreserved ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the respective feed media ActiCHO Feed a and ActiCHO Feed B (both GE Healthcare). Inoculation cultures were obtained by expansion of ConM and ConS lead clones from MCBs in production medium (ActiCHO P medium supplemented with 8 mM L-glutamine ...
-
bioRxiv - Plant Biology 2022Quote: Method B) Genomic DNA was extracted using the Nucleon Phytopure DNA extraction kit (GE Healthcare Gio-Sciences ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a glutathione-S-transferase (GST) (64) and thrombin sequence derived from pGEX-2T (GE Healthcare, Chicago, IL), and a maltose binding protein (MBP ...
-
bioRxiv - Molecular Biology 2024Quote: ... coding sequences of AtCFI25a and AtCFI59 were cloned into pGEX5X-2 (GST) (Merck/GE Healthcare, Darmstadt, Germany) or pET30c (HIS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each eIF4E sequence was also sub-cloned into a re-engineered bacterial expression vector pGEX-4T (GE Healthcare), now pGEX-4T(MCS)-TEV ...
-
bioRxiv - Biochemistry 2021Quote: ... 300 mM NaCl (IMAC B buffer) and loaded onto a 5 mL HiTrap IMAC column (GE Healthcare) using an Äkta Start Chromatography system ...
-
bioRxiv - Plant Biology 2021Quote: Purification of cardosin B was performed and monitored by chromatography using an AKTA system (GE Healthcare, USA). 20X concentrated protein extract (10 ml ...
-
bioRxiv - Microbiology 2022Quote: ... 1mM b-ME) and further purified by Size Exclusion Chromatography (HiLoad 26/600 Superdex 200, GE Healthcare), pre-equilibrated with buffer E (20 mM HEPES pH 8.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... In a 48 well plate, 25-32.5μL siRNA (for sequences, see table 1) was mixed with 25uL 1x siRNA buffer (GE Healthcare) containing 0.5uL Dharmafect 1 transfection reagent ...
-
bioRxiv - Cell Biology 2021Quote: cDNA encoding human Nup35 was amplified from MGC Human Nup35 sequence-verified cDNA (Accession number BC047029, GE Healthcare, Dharmacon), using primers that add an amino terminal HA tag ...