Labshake search
Citations for IDT DNA :
1 - 17 of 17 citations for 5 Cyanopyridin 3 yl methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... (pan)Ifna (Forward: 5’-CTTCCACAGGATCACTGTGTACCT-3’; Reverse: 5’-TTCTGCTC TGACCACCTCCC-3’; Probe: 5’-AGAGAGAAGAAACACAGCCC CTGTGCC-3’; IDT DNA)(Samuel & Diamond ...
-
bioRxiv - Immunology 2020Quote: ... 160 ng DNA was quantified for MCMV IE1 (Forward: 5’-CCCTCTCCTAACTCTCCCTTT-3’; Reverse: 5’-TGGTGCTCTTTTCCCGTG −3’; Probe: 5’-TCTCTTGCCCCGTCCTGAAAACC-3’; IDT DNA) and host Actb (Forward ...
-
bioRxiv - Biochemistry 2021Quote: RNA-ARE probes were designed from the Fgf21-3’UTR ARE sequence and synthesized with 5’-biotin end-labelling (IDT DNA technologies). HEK293 cells were transfected with the ZFP36L1 expression plasmid (pcDNA 3.1+/C-(K)-DYK Zfp36l1 ...
-
bioRxiv - Microbiology 2021Quote: ... The 5’6-FAM/dArUdAdA/3’-TAMRA oligonucleotide was purchased from IDT DNA Inc (Coralville ...
-
bioRxiv - Bioengineering 2023Quote: ... at a final concentration of 3 μM and electroporation enhancer (IDT DNA) at a final concentration of 30 μM were added to the gRNA mix ...
-
bioRxiv - Immunology 2021Quote: ... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
bioRxiv - Biophysics 2022Quote: DNA sequences with 5’ lipids were custom ordered from IDT DNA. DNA Sequence ‘C’ used to tether liposomes is /5DPPEK/TA GTA TTC AAC ATT TCC GTG TCGA and complementary DNA sequence ‘D’ incorporated in viral particles is /5DPPEK/TT TTT TTT TTT TTT TTT TTTTTT TTC GAC ACG GAA ATG TTG AAT ACTA with T24 linker as previously used (21) ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
bioRxiv - Biophysics 2023Quote: ... DNA templates were generated by PCR using a 5’-ATTO647-funtionalized (IDT DNA) 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843 ...
-
bioRxiv - Microbiology 2020Quote: ... a synthetic fragment for a recodonized 3’ sequence of exon 1 followed by the artificial loxPint (IDT DNA), and a PCR-amplified fragment of the 5’ end of pfpp1 exon 2 (601 bp) ...
-
bioRxiv - Microbiology 2021Quote: ... these were run as two separate multiplex PCR “pools” (A & B) using the ARTIC version 3 primer set (ARTIC nCoV-2019 V3 Panel, IDT DNA Inc ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting plasmid pLN-PP1-HA3-loxP was further modified to target endogenous pfpp1 with HA3 and loxP by introduction of a 5’ homology region for the gene (HR1, 682 bp of genomic DNA sequence for exons 2 and 3) fused to a recodonized synthetic fragment (IDT DNA) for exons 4 and 5 ...
-
bioRxiv - Immunology 2021Quote: ... 0.7 µl template switch oligo (TSO) (10 µM, f/c 200 nM, IDT DNA; #110, Supplementary table 5), nuclease-free water till 35 µl and subsequent incubation at 42°C for 2 hours ...
-
bioRxiv - Biophysics 2023Quote: ... all the DNA oligonucleotides were ordered with 5’-modification of Alexa Flour 488 fluorophore (from IDT DNA, Supplementary Table I).
-
bioRxiv - Genetics 2020Quote: ... The hybridization solution is as follows: 0.6ng/ml Cy5 labeled 2’-O-Me-(CCCCGG)5 RNA probe (IDT DNA Technologies, IA), 0.02% BSA ...
-
bioRxiv - Biophysics 2023Quote: ... 5’ primer with homology to linker DNA upstream of ∼60 bp of pericentromeric DNA and the centromere (SB7843) and a 5’-biotinylated (IDT DNA) 3’ primer with linker DNA ...