Labshake search
Citations for Millipore Sigma :
1 - 50 of 2529 citations for pVectOZ GFP Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... or control shRNAs for GFP (Sigma) and luciferase (Sigma ...
-
bioRxiv - Systems Biology 2020Quote: ... Negative controls consisted of transfection with the MISSION siRNA Universal Negative Control (Sigma-Aldrich; Cat#SIC001; Lot#WDAA1199). Predesigned MISSION siRNA’s targeting individual genes were ordered from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... transfection of 30pmol/ml Mission siRNA Universal Negative Control #1 (Sigma-Aldrich) was used as a control.
-
bioRxiv - Biophysics 2020Quote: ... expressing vimentin with a GFP tag were produced by lentiviral transfection (LentiBrite GFP-Vimentin Lentiviral Biosensor, Merck Millipore) of HeLa cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... or scrambled negative control lentiviral particles (SMARTvector Non-targeting hCMV-TurboGFP Control Particles, Dharmacon, #S-005000-01) and polybrene transfection reagent (Millipore). The packaged viral vectors encode green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 60 ng/well of esiRNA targeting either GFP (control) (Sigma, EHUEGFP), or FFLuc (Sigma ...
-
bioRxiv - Physiology 2020Quote: ... or negative control siRNA using Mission siRNA transfection reagents (Sigma-Aldrich, St. Louis, MO, USA) for 48 h ...
-
bioRxiv - Developmental Biology 2019Quote: Control or jnk1a morphant embryos (myh7:gfp) were incubated in 10mM BrdU (B5002, Sigma) in 15% DMSO for 30 min on ice at 16 somites ...
-
bioRxiv - Neuroscience 2022Quote: ... neurons were fixed at Day 30 (2 days after transfection with GFP) using 3.7 % formaldehyde (Sigma) in 4% sucrose/PBS for 15 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... were transduced to stably express cytoplasmic fluorescence (LentiBriteTM GFP Control Lentiviral Biosensor 17-10387, Millipore Sigma) and cultured in Vasculife Endothelial Medium (LL-0003 ...
-
bioRxiv - Cell Biology 2023Quote: SV589/NAGTI-GFP cells grown on glass coverslips were transfected with siRNA Universal Negative Control #1 (Sigma) or duplexes targeting GM130 or FXR1 (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... SMA 7.12 and SMA 8.2 were made into GFP- and RFP-expressing stable lines by infecting cells with LentiBrite GFP Control Lentiviral Biosensor (Millipore, #17-10387, titer 7.34 x108 IFU/mL) or LentiBrite RFP Control Lentiviral Biosensor (Millipore ...
-
ALS iPSC-derived microglia and motor neurons respond to astrocyte-targeted IL-10 and CCL2 modulationbioRxiv - Neuroscience 2023Quote: ... SOD1 and C9ORF72 lines were made into GFP– and RFP-expressing stable lines by infecting cells with LentiBrite GFP Control Lentiviral Biosensor (Millipore, #17-10387, titer 7.34 x108 IFU/mL) or LentiBrite RFP Control Lentiviral Biosensor (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... Cultured 3T3-L1 preadipocytes were infected control (Scr; H2B-GFP) or gene-specific lentiviruses with Polybrene (Sigma-Aldrich) at a final concentration of 100µg/ml.
-
bioRxiv - Neuroscience 2021Quote: ... Electroporated neurons were identified by visualizing the control GFP or by staining for the V5 (1:500, Sigma) tag on Inpp5k ...
-
bioRxiv - Immunology 2019Quote: MCA205 and B16F10 mouse cell lines are transfected with the plasmid YFP-Globin-SL8-intron or with the PCDNA3 empty plasmid (negative control) with the transfection reagent jetPRIME (Ozyme) or GeneJuice (Millipore) respectively according to each manufacturer protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then pSIREN-RetroQ-Sirt7 and the negative control vector (pSIREN-RetroQ) were transfected into HEK293 cells using PEI transfection reagent (Sigma). The pSIREN-RetroQ-Sirt7 and the negative control vector (pSIREN-RetroQ ...
-
bioRxiv - Molecular Biology 2023Quote: Chondrocytes were transiently transfected with siRNA targeting Tnxb (GenePharma) or negative□control siRNA (scrambled; GenePharma) using X□tremeGENE siRNA transfection reagent (Sigma) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-human-Dia2-isoform1 (gift from Véronique Pizon) and GFP-mouse-Dia2-isoform3 (gift from Yosuke Senju) using X-tremeGENETM HP DNA Transfection Reagent (Sigma) according to the manufacturer’s instructions cultured for a total of 2 days ...
-
bioRxiv - Cell Biology 2021Quote: ... expressing either His2Av::GFP or UAS-Cherry::Tubulin under the control of Insc-Gal4 were dissected in sterile PBS (Sigma). One brain lobe was transplanted in the abdomen of a wild-type adult fly using a pulled capillary with a beveled tip (around 150 μm diameter ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1,5 μg/μL CDC25B or control vector was co-injected with 1 μg/μL pCIG-GFP and Fast Green (Sigma) in the lateral ventricle of embryos neocortex ...
-
bioRxiv - Cancer Biology 2022Quote: Human NSCLC cell lines transiently transfected with either control GFP or one of three different IKKα plasmids were lysed in RIPA buffer (Millipore) supplemented with protease inhibitors (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were infected with either of the sgPLXNB2 clones or the control sgRNA with Cas9-GFP virus (Sigma-Aldrich #0030) at 10 IFU/cell in Opti-MEM (Thermo Fisher Scientific #31985070 ...
-
bioRxiv - Microbiology 2023Quote: ... Transfection was performed using RNAIMax transfection reagent (Sigma).
-
bioRxiv - Cell Biology 2020Quote: Purification of mammalian Cavin1 was performed by Transfecting GFP-tagged Cavin1 using polyethylenimine (PEI) transfection reagent (Sigma-Aldrich Cat. No. 408727) with 1:4 w/w ratio (DNA:PEI ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids were introduced in RPE-1 cells using Fugene HD transfection reagent and cells were selected based on GFP-expression or using 7 μg/mL puromycin (Sigma Aldrich) for 5 days.
-
bioRxiv - Neuroscience 2023Quote: ... The shRNA universal negative control (Sigma, Control shRNA) was used as a non-targeting control (Suppl ...
-
bioRxiv - Neuroscience 2024Quote: ... The shRNA universal negative control (Sigma, Control shRNA) was used as a non-targeting control (Suppl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable KD of EIF4G2 was generated by infecting HEC-1A or RL95-2 cells with lentiviruses harboring pLKO.1-puro plasmid expressing shRNA targeting GFP (Control) or shRNA targeting EIF4G2 (Sigma TRCN0000147914), followed by selection using puromycin ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection was performed using X-tremeGENE transfection (6365787001; Sigma Aldrich) reagent according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... or the negative control siRNA (Sigma, Universal Negative control B) solution containing 10 mM phosphate ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control non-target MISSION control shRNA (available through Sigma). MDA-231 and BT-549 cells were modified with NLS-RFP (pCDH-CMV-3xNLS-TagRFP-T-EF1-blastiSBT-549 [30] ...
-
bioRxiv - Developmental Biology 2020Quote: ... Control siRNA were used as negative controls (Sigma, SIC001-10NMOL). Briefly ...
-
bioRxiv - Microbiology 2023Quote: Highly synchronized ring stage parasite cultures of line MD3-pfama1-GFP-BirA and Percoll-purified immature gametocyte cultures of the MD3-pffnpa-GFP-BirA parasite line as well as WT NF54 as control were treated with biotin (Sigma-Aldrich; Taufkirchen, DE), at a final concentration of 50 µM for 24 h to induce the biotinylation of proximal proteins by the BirA ligase ...
-
bioRxiv - Developmental Biology 2021Quote: ... Control (Sigma #SIC001), and a mix of two Lrrfip2 (Sigma #s89557 #89558 ...
-
Constitutive and conditional epitope-tagging of endogenous G protein coupled receptors in DrosophilabioRxiv - Neuroscience 2023Quote: Myristoylated GFP (myr::GFP) was labeled with 1:500 mouse anti-GFP (Sigma-Aldrich, Cat#G6539 ...
-
bioRxiv - Physiology 2020Quote: ... SASI_Rn02_00389576) or the negative control siRNA (Sigma, Universal Negative control B) solution containing 10 mM phosphate ...
-
bioRxiv - Cancer Biology 2020Quote: ... or scrambled control siRNA (siCTR) (siRNA universal negative control, Sigma-Aldrich) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... GFP (Sigma), PolII CTD ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFP (Millipore), pHistone 3 S10 (Millipore) ...
-
bioRxiv - Molecular Biology 2023Quote: Lentivirus was produced in HEK 293T cells by jetPEI transfection (Polyplus Transfection, Illkirch, France) or X-tremeGENE 9 DNA Transfection Reagent (Sigma) of a pLenti ...
-
bioRxiv - Neuroscience 2020Quote: ... and GFP (1:1000 rabbit anti-GFP, Millipore #AB3080P); in blocking buffer overnight (4°C) ...
-
bioRxiv - Microbiology 2021Quote: ... DMSO (negative control; AppliChem) or 40 ng/ml ciprofloxacin (positive control; Sigma). The optical density of each culture was determined ...
-
bioRxiv - Genetics 2020Quote: ... or negative control siRNA (MISSION® siRNA Universal Negative Control #1, Sigma), respectively ...
-
bioRxiv - Genomics 2023Quote: Universal negative control siRNA (Mission siRNA Universal Negative Control #1, SIC001, Sigma) and ILF3 siRNA1 and ILF3siRNA2 (ILF3_1 PDSIRNA2D ...
-
bioRxiv - Genetics 2023Quote: ... or a negative control siRNA (siRNA Universal Negative Control #1, Sigma-Aldrich), using Lipofectamine RNAiMax (Invitrogen) ...
-
bioRxiv - Biophysics 2019Quote: ... via polyethylenimine transfection (Sigma). Lentiviral particles were harvest at 36 and 72 hours post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... transfection of siRNA (Sigma, pool of two siRNAs ...
-
bioRxiv - Cancer Biology 2019Quote: ... PEI transfection reagent (Sigma) in 100µl serum-free DMEM (LifeTech) ...