Labshake search
Citations for Millipore Sigma :
1 - 50 of 77 citations for p5 Ligand for Dnak and and DnaJ since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... ligands [(+)-pentazocine (Sigma), PD 144418 (Tocris) ...
-
bioRxiv - Cell Biology 2021Quote: ... P5-Di(adenosine-5’) pentaphosphte (Ap5A) (Sigma-Aldrich) was included in the respiration medium to inhibit adenylate kinase and to ensure that ATP production was solely due to mitochondrial oxidation phosphorylation ...
-
bioRxiv - Neuroscience 2023Quote: ... triazole ligand (Sigma, # 678937), TCEP (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 300μM Triazol ligand (Sigma, #678937) and 84μg/ml CuBr (prepared by a 10mg/ml dilution in DMSO ...
-
bioRxiv - Molecular Biology 2022Quote: ... and standard desalted p5 and p7 primers (Sigma, Table S1), containing inline-barcodes for multiplexing and partial adapters for Illumina sequencing ...
-
bioRxiv - Biochemistry 2019Quote: ... Tested ligands: AMP-PNP (Sigma Aldrich), ADP (Sigma Aldrich) ...
-
Oxytocin receptor activation does not mediate associative fear deficits in a Williams Syndrome modelbioRxiv - Animal Behavior and Cognition 2021Quote: ... All unlabeled ligands were from Sigma. Incubation was carried out for two hours at 22-23 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligands include: NADP+ (Sigma-Aldrich, 077K7000), NAD+ (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... We used two ligands hemin (Sigma) and AMP.PNP ...
-
bioRxiv - Biophysics 2023Quote: ... Ligands were obtained from Sigma-Aldrich (aldosterone ...
-
bioRxiv - Immunology 2023Quote: ... FLT3-ligand and beta estradiol (Sigma). All the HoxB8 cells were transduced with retroviral vectors obtained from Plat-E cell lines ...
-
bioRxiv - Biophysics 2020Quote: Ligands were purchased from Sigma Aldrich (USA). Retinol and resveratrol were solubilized in deuterated ethanol (d6 ...
-
bioRxiv - Developmental Biology 2022Quote: ... All ligands were purchased from Sigma-Aldrich and reconstituted in ethanol ...
-
bioRxiv - Neuroscience 2020Quote: ... All sugar ligands were purchased from Sigma.
-
bioRxiv - Biophysics 2023Quote: ... All ligands were obtained from Sigma-Aldrich.
-
bioRxiv - Developmental Biology 2022Quote: ... P4 and P5 mice were intraperitoneally injected with 50ug TAM (Sigma-Aldrich #T5648); adult mice were treated with 100 μg/g body weight of TAM on three consecutive days.
-
bioRxiv - Cancer Biology 2023Quote: ... THPTA ligand (100 μM, Cat# 762342, Millipore Sigma) and mixed on a rotor at room temperature for 2 h ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5 mM of ligands (purchased from Sigma) such as ornithine ...
-
bioRxiv - Biochemistry 2021Quote: ... 26.6 μM P1,P5-di(adenosine-5□) pentaphosphate (Sigma-Aldrich, St. Louis, MO, USA), 20 μL inverted membranes ...
-
bioRxiv - Immunology 2020Quote: ... laminarin from Laminaria digitata (Dectin-1 ligand, Sigma-Aldrich). The PRR agonists were used alone or in combination with 20 ng/mL mouse recombinant IFN-γ (Peprotech).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... all small molecule ligands were obtained from Millipore Sigma or Cayman Chemical ...
-
bioRxiv - Biochemistry 2020Quote: ... Components for solubilisation buffer and ligands for both ThermoFRET stability assay and fluorescent ligand binding experiments were obtained from Sigma-Aldrich (Havervill, UK) and Anatrace (Ohio ...
-
bioRxiv - Cell Biology 2021Quote: ... Slit guidance ligand 2 (SLIT-2-N; Sigma, cat#SRP3155), prostaglandin E2 (PGE2 ...
-
bioRxiv - Systems Biology 2022Quote: ... coli LPS (1 and 100 ng/mL - Sigma; TLR4 ligand) and Pam3Cys ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2023Quote: ... daily for three consecutive days at P5-P7 with 200 mg/kg doxycycline hyclate (Sigma Aldrich, D9891). iH2B-FT mice were then analyzed at P8 ...
-
bioRxiv - Neuroscience 2020Quote: ... All caloric and non-caloric sugar ligands were purchased from Sigma and dissolved in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Poly(I:C) and salmon sperm DNA ligands were acquired from Sigma. Followin treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... 70% confluent ASCs monolayers at P5 or P25 were incubated with 5 mg/ml cytochalasin B (Sigma Aldrich) for 48 h at 37°C and 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... by the luciferin/luciferase system supplemented with 25 µM P1,P5-di(adenosine-5’) pentaphosphate (AP5A; Sigma Aldrich), 3 µM IF1 (prepared as described previously (85) ...
-
bioRxiv - Biochemistry 2022Quote: ... The ligand Ala-Ala were filtered through 0.45 µm nitrocellulose filters (Millipore). Cells were lysed in 0.1M NaOH and 1% SDS for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... Eluted HLA ligands were purified by ultrafiltration using centrifugal filter units (Millipore). Peptides were desalted using ZipTip C18 pipette tips (Millipore) ...
-
bioRxiv - Immunology 2023Quote: ... A 30-mer biotinylated single-stranded DNA ligand (0.025 μM, Sigma-Aldrich) was then immobilized onto the MC5 chip in FC2 through interaction with neutravidin ...
-
bioRxiv - Molecular Biology 2024Quote: PPARα ligands GW7647 (GW) and pemafibrate (pema) were purchased from Sigma-Aldrich and Bioconnect ...
-
bioRxiv - Biochemistry 2023Quote: Ligand binding to commercial wild type HSA (non-defatted, Sigma-Aldrich A1653) and to HSA1 variant (His-tagged ...
-
bioRxiv - Cell Biology 2023Quote: ... Ten µL of ligand (10-5 M isoproterenol or Thrombin (Sigma Cat# T4648) at 100 U/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 nanomoles of JF552-Halotag ligand were dissolved in 20μl of DMSO (Sigma), diluted first in 20 μl of Pluronic™ F-127 (20% w/v in DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.15×106 of murine stromal cells expressing human delta like ligand 1 (Sigma) were combined with 7.5×103 of sorted and enriched KO-/- ...
-
bioRxiv - Neuroscience 2021Quote: ... P3 and P5 pups were injected intraperitoneally with 50 mg/kg of EdU (P5 pups only) or 50 mg/kg of tamoxifen (Sigma) dissolved in corn oil ...
-
bioRxiv - Biophysics 2019Quote: ... The ligand phenylethyl β-D-thiogalactopyranoside (PETG) was purchased from Sigma-Aldrich (catalog #P1692) and prepared as described38 ...
-
bioRxiv - Immunology 2019Quote: ... CHO ligand anchor cells were maintained in L-Glutamine-free DMEM (Sigma-Aldrich # D6546) supplemented with 5% dialysed FBS (dialysed thrice against 10 L PBS) ...
-
bioRxiv - Biochemistry 2023Quote: ... coenzyme A and P1,P5-Di (adenosine-5′) pentaphosphate pentasodium salt (Ap5A) were purchased from Sigma-Aldrich (St Louis, MO, USA). D-luciferin was purchased from Molecular Probes Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... the long-lasting dopamine receptor ligand [3H] 2-amino-6,7-dihydroxy 1,2,3,4-tetrahydronapthalene (ADTN) (Sigma) was injected to a final estimated concentration of 200 nM ...
-
bioRxiv - Neuroscience 2022Quote: ... the long-lasting dopamine receptor ligand [3H] 2-amino-6,7-dihydroxy 1,2,3,4-tetrahydronapthalene (ADTN) (Sigma) was injected to a final estimated concentration of 200 nM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 50 ng mL−1 receptor activator of nuclear factor kappa-B ligand (Sigma Aldrich). The scaffold was then perfused at 56 μL per second for 28 days in the same medium ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp., St. Louis, MO, USA), or control phosphate-buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ligand of different concentrations was mixed with forskolin at the final concentration of 1 μM (Sigma) and the mixture was added to each well (10 μL /well) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... allowing intraluminal perfusion (10 ml.hr-1) of vehicle or test ligands using a syringe pump (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2019Quote: ... 3 μL of 1× ligand (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Sigma-Aldrich) 20% DMSO in t-butanol) ...
-
bioRxiv - Immunology 2023Quote: ... CHO ligand anchor cells (short and long) were maintained in L-Glutamine-free DMEM (Sigma-Aldrich #D6546) supplemented with 10% dialysed FBS (dialysed three times against 10 L PBS) ...