Labshake search
Citations for Millipore Sigma :
1 - 50 of 3340 citations for VAPB Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... anti-VAPB (Sigma Cat# HPA013144), anti-Spastin (Sigma Cat# ABN368) ...
-
bioRxiv - Cell Biology 2023Quote: ... VAPB siRNAs (GCUCUUGGCUCUGGUGGUUUU and AAAACCACCAGAGCCAAGAGC; Sigma) and ON-Target-plus nontargeting siRNA (D-001810-01-50 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-VapB (Sigma-Aldrich; catalogue no. HPA013144), anti-TGN46 (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... GST-VAPB was expressed in BL21 Rosetta (DE3) cells (EMD Millipore) induced with 1 mM IPTG for 4 h ...
-
bioRxiv - Neuroscience 2019Quote: ... and His-tagged human HDAC6 protein (EMD Millipore) were incubated with 57 nm 32P-ATP in kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... We used rabbit polyclonal antibodies against VAPB (1:3000, HPA013144, Sigma-Aldrich) and vinculin (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... was incubated with recombinant His-tagged human HDAC6 protein (EMD Millipore) in 250 μl RB100 buffer (25 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Biophysics 2021Quote: His-tagged human PCNA protein was purchased from Sigma Aldrich (catalogue number SRP5117), at a concentration of 6.6 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... respectively (Millipore Cat# HI-14K, HI-13K). Samples treated with 3 mM glucose KRBH were measured undiluted ...
-
bioRxiv - Molecular Biology 2019Quote: ... His-GFP or His-fusion proteins were bound to HIS-Selec HF Nickel Affinity Gel (Sigma) for 1 hour ...
-
bioRxiv - Cell Biology 2019Quote: ... α-His (Sigma H1029). α-Rabbit IgG HRP conjugate (Promega W4011) ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 μg of purified His fusion protein (PuBZR1-His) was bound to Ni-NTA His binding resin (Novagen). GST fusion proteins containing PuACO1 (PuACO1-GST ...
-
bioRxiv - Microbiology 2022Quote: ... SasG-His was then re-purified using HIS-Select resin (Sigma) and eluted with bind buffer containing increasing concentrations of imidazole ...
-
bioRxiv - Systems Biology 2021Quote: ... separated proteins were transferred to a PVDF membrane using a semi-dry system and His-tagged proteins (hCDKL5 and His-Neuropilin) were detected with a HRP-conjugated anti-His antibody (1:2,000, Sigma) using the Enhanced Chemiluminescence kit (ECL ...
-
bioRxiv - Immunology 2022Quote: ... containing 2% (vol/vol) of heat inactivated (HI, for 1h at 56°C) human AB serum (hABS) (Sigma, #H3667). After extensive washings with DPBS (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... HIS (Sigma-Aldrich H3667), purified full-length Vn (1 μM in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-His (Millipore, USA), anti-GST (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... or anti-His (Novagen) antibodies to detect Ub conjugates.
-
bioRxiv - Plant Biology 2020Quote: ... and anti-His (Sigma) antibodies.
-
bioRxiv - Plant Biology 2020Quote: ... and anti-His (Sigma) antibodies at a 1:2000 dilution ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-His (Sigma, H1029) 1:2000 ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-His (Sigma H1029), anti-GFP (Agrisera ...
-
bioRxiv - Molecular Biology 2020Quote: ... cleaved His-tag and His-tag-fused TEV protease were removed using a HIS-Select® Nickel Affinity Gel (Sigma-Aldrich) column ...
-
bioRxiv - Microbiology 2019Quote: ... Bound His-tagged proteins were detected using HRP-conjugated anti-His antibodies (Sigma) at a 1:500 dilution ...
-
bioRxiv - Biophysics 2019Quote: ... His-EmGFP-DBNL and his-mCherry-DBNL were diluted in PBS (D8537, Sigma-Aldrich) to 1 nM each and 30 µl of mixed sample solution was placed on top of a cleaned glass cover-slip for measurement ...
-
bioRxiv - Plant Biology 2021Quote: ... Fusion proteins with His tag were purified using Ni-NTA His binding resin (Novagen) and those with GST tag was purified by glutathione sepharose (Novagen).
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were purified with His-Bind Resin and His-Bind Buffers (Merck Millipore) according to manufacturer’s protocol and stored at a concentration of 2mg/ml in elution buffer (Merck Millipore ...
-
bioRxiv - Microbiology 2019Quote: ... anti-His (1:1000 Sigma), or anti-StrepII (1:3000 IBA ...
-
bioRxiv - Cancer Biology 2019Quote: ... rabbit anti-His (Sigma Aldrich), rabbit anti-Tubulin polyclonal antibody (Cell Signaling Technology).
-
bioRxiv - Molecular Biology 2020Quote: ... HIS-tag (Sigma-Aldrich H1029), and Streptactin-HRP (ThermoFisher Scientific #21130) ...
-
bioRxiv - Microbiology 2023Quote: The His-tag system (Novagen) was used for Sif purification ...
-
bioRxiv - Molecular Biology 2021Quote: ... and input TRF1 mutants were revealed with anti-His (anti 6-His Rabbit Pab Sigma Aldrich). For the detection of biotin-labelled PARylated proteins the same assay was conducted in presence of biotin-NAD+ (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fractions containing His-tagged protein as verified by Western blot with an anti-His antibody (Sigma) were pooled and loaded onto the StrepTrap column ...
-
bioRxiv - Microbiology 2022Quote: ... Sub-confluent T175 flasks of 293T cells (human embryonic kidney cell line) were transfected with the RBD-His tagged plasmid using X-tremeGENE 9 reagent (Millipore Sigma, Cat# 6365809001). The supernatant was collected six days post-transfection and filtered through 0.22μm PES membrane filters (Nalgene) ...
-
bioRxiv - Microbiology 2021Quote: ... Sub-confluent T175 flasks of 293T cells (human embryonic kidney cell line) were transfected with the RBD-His tagged plasmid using X-tremeGENE 9 reagent (Millipore Sigma, Cat# 6365809001). Supernatant was collected 6 days post-transfection and filtered through 0.22 μm PES membrane filters (Nalgene) ...
-
bioRxiv - Cell Biology 2024Quote: ... was added to the cell pellet and stored at −20°C prior to being assayed for insulin using human insulin specific RIA (Millipore Cat# HI-14K).
-
bioRxiv - Biophysics 2021Quote: ... or anti-His antibodies (Sigma- Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... or anti-His (1:1000 Sigma) overnight at 4 °C and anti-mouse secondary (1:5000) ...
-
bioRxiv - Microbiology 2021Quote: ... α-His (Sigma, cat# H1029, 1: 3,000), α-ICDH (1 ...
-
bioRxiv - Microbiology 2020Quote: ... α-His(Sigma, cat# H1029, 1: 10,000), α-HA (Santa Cruz ...
-
bioRxiv - Cell Biology 2022Quote: ... anti- HIS from Novagen (70796-3), anti-TGN38 from BD Transduction (610898) ...
-
bioRxiv - Biochemistry 2019Quote: His-select Cobalt affinity beads (Sigma) were equilibrated in binding buffer (40 mM HEPES pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-His (Sigma-Aldrich, H1029, RRID:AB_260015), anti-Strep (IBA GmbH ...
-
bioRxiv - Biochemistry 2023Quote: ... or anti-His antibody (EMD Millipore) as described previously [39] ...
-
bioRxiv - Biochemistry 2023Quote: ... or anti-His antibody (EMD Millipore) as described previously [39] ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-HIS (Sigma H1029 1:2,500) or anti-MBP (New England Biolabs E8032 ...
-
bioRxiv - Neuroscience 2023Quote: ... His•Tag® (Millipore, 70796-3), anti-APP C-Terminal Fragment (BioLegend ...
-
bioRxiv - Cell Biology 2020Quote: ... His-tagged proteins were immobilized on Ni-NTA His-Bind® Superflow™ Resin (Merck Millipore, 70691), washed and eluted in SB buffer (30 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies used for protein quantification for ELISAs were mouse monoclonal anti-His (His-Tag mAb, EMD-Millipore), and biotinylated mouse anti-rat Cd4 (clone OX68) ...