Labshake search
Citations for Millipore Sigma :
1 - 50 of 5746 citations for Two Hybrid System Construction kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Two pLKO.1-shRNA constructions against the HDAC6 transcript were selected from the MISSION shRNA collection (SIGMA Aldrich). The constructs references were TRCN0000314976 for sh1_HDAC6 and TRCN0000004839 for sh2_HDAC6 ...
-
bioRxiv - Plant Biology 2019Quote: ... at least four independent colonies were used for yeast two-hybrid assay on SD-Leu-Trp-His plates with and without 3-amino-1,2,4-triazole (Sigma). Colonies were imaged every 24 h post plating for 4-5 days.
-
bioRxiv - Synthetic Biology 2019Quote: ... hairy roots transformed with the EI LUC and EI PhiC31 constructions were divided in two portions and separated in MS medium supplemented or not with 20 μM β-estradiol (Sigma-Aldrich). After 3 days ...
-
bioRxiv - Biophysics 2023Quote: ... Aqueous two-phase systems with PEG-35k (Sigma) and Dextran T500 (Pharmocosmos ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA for library construction was extracted using a Spectrum Plant Total RNA Kit (Sigma). RNA quality was assessed using an Agilent 4200 TapeStation ...
-
bioRxiv - Microbiology 2019Quote: ... Oligonucleotides used for plasmid construction were purchased from Sigma and are listed in Table S2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA-RNA hybrid (Sigma-Aldrich, MABE1095), and anti-DNA PKcs (phospho S2056 ...
-
bioRxiv - Molecular Biology 2021Quote: ... All ODNs for plasmid construction were purchased from Sigma-Aldrich Japan (Tokyo ...
-
bioRxiv - Plant Biology 2022Quote: ... These constructions were transformed into Escherichia coli BL21 host strains (Novagen). GST fused proteins were induced with 0.5 mM isopropyl β-d-1-thiogalactopyranoside for 20 hours at 28°C ...
-
bioRxiv - Microbiology 2023Quote: ... and other plasmid construction are located in Table S2 (Sigma Aldrich). Bacterial strains and plasmids used or generated in this study are described in Table S1.
-
bioRxiv - Molecular Biology 2020Quote: Antibodies: anti-DNA-RNA hybrid S9.6 (Millipore, MABE1095), HA (Santa Cruz ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Dimethyl sulfoxide (DMSO) hybrid-max sterile (Sigma, D2650) was diluted in fish water to a final concentration of 0.1% (v/v) ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA oligonucleotides for vector construction and sequencing were obtained from Millipore Sigma. Sequence of all plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA oligonucleotides or vector construction and sequencing were obtained from Millipore Sigma, synthetic DNA fragments for Gibson Assembly – from IDT ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA-DNA Hybrid clone S9.6 (1:200; MABE1095; Millipore), CENP-C (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... α-DNA-RNA hybrid (S9.6) antibody is from Sigma Aldrich.
-
bioRxiv - Molecular Biology 2021Quote: ... anti-DNA:RNA hybrid clone S9.6 (mouse, MABE1095 [Merck Millipore] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Anti-DNA-RNA hybrid antibody S9.6 (MABE1095, Sigma-Aldrich), anti-NRBP1/2 antibody (21549-1-AP ...
-
bioRxiv - Microbiology 2023Quote: ... 2% 50X HT Media Supplement Hybrid-MaxTM (Sigma, H0137), 1% 200 mM L-Glutamine (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... 2% 50X HT Media Supplement Hybrid-MaxTM (Sigma, H0137), 1% 200 mM L-Glutamine (Gibco ...
-
bioRxiv - Genomics 2021Quote: We extend our TWO-SIGMA method [38] to competitive gene set testing via TWO-SIGMA-Geneset (TWO-SIGMA-G), on overview of which is shown in Figure 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Two microlitres of the supernatant was used for protein quantification using the Direct Detect system (Merck Millipore). The acquired concentrations of intracellular c-di-GMP were normalized to the total protein content.
-
bioRxiv - Microbiology 2024Quote: ... Antibiotics used to select transformants during strain construction were cefotaxime (10 mg/L, Sigma) and kanamycin (50 mg/L ...
-
bioRxiv - Genomics 2023Quote: ... for non-hybrid crosses covered with mineral oil (Sigma Cat# M8410) at 37°C with 5% CO2 and 5% O2 air.
-
bioRxiv - Neuroscience 2020Quote: ... Two mM of ANS (Sigma) stock solution was prepared in PBS pH 7.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... Two-mM thymidine (Sigma-Aldrich) was applied to the culture medium for 12 hours to arrest the cells at the stage of G1/S phase transition ...
-
bioRxiv - Plant Biology 2021Quote: ... Two pairs of oligos (Sigma) corresponding to the consensus gRNA target site in exon two of MYB186 (Potri.008G089200) ...
-
bioRxiv - Neuroscience 2023Quote: ... two DiI coated (Sigma-Aldrich) laminar 32 channel probes (H4 ...
-
bioRxiv - Genomics 2023Quote: Two different linkers (Sigma-Aldrich), a 5’ linker and a 3’ linker ...
-
bioRxiv - Genetics 2023Quote: ... two oligonucleotides were synthesized (Sigma), annealed and cloned into a CRISPR-Cas9 expression vector (pX330-hCas9-long-chimeric-grna-g2p ...
-
bioRxiv - Cell Biology 2020Quote: ... After two days cells were harvested and lysed using the MAGNA-RIP kit (Millipore 17-700) according to the manufactureŕs protocol ...
-
bioRxiv - Physiology 2024Quote: ... connected to two current and two voltage electrodes filled with 1.5% (w/v) agar (Millipore) dissolved in 3M KCl ...
-
bioRxiv - Neuroscience 2020Quote: ... two-trial analog training was delivered by two pulses of 5HT (50 μM, Sigma, #H9523-25MG) in ASW (ITI = 45 min) ...
-
bioRxiv - Cell Biology 2021Quote: ... with two vectors from Sigma-Aldrich, targeting the two stress-inducible Hsp70 variants Hspa1a (Gene ID ...
-
bioRxiv - Molecular Biology 2021Quote: ... to two different siRNAs (Sigma Millipore) (start on target sequence CDS position 2393bp-sense ...
-
bioRxiv - Molecular Biology 2021Quote: ... to two different siRNAs (Sigma Millipore) (start on target sequence CDS position 2393bp-sense ...
-
bioRxiv - Neuroscience 2021Quote: ... two from Sigma-Aldrich (Poole, UK) and one from Amersham ...
-
bioRxiv - Immunology 2020Quote: ... Two units of biotinylated thrombin (Millipore) were mixed with each 1 mg of protein overnight to cleave off tags ...
-
bioRxiv - Neuroscience 2021Quote: ... Two μl of 6-OHDA (Sigma) (5 μg/μl ...
-
bioRxiv - Cell Biology 2022Quote: ... to transfect two siRNAs (Sigma-Aldrich) for each target mRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... two conditions of ML323 (Sigma Aldrich) treatment were maintained ...
-
bioRxiv - Biophysics 2023Quote: ... We used two ligands hemin (Sigma) and AMP.PNP ...
-
bioRxiv - Molecular Biology 2021Quote: ... The captured DNA-RNA hybrids were enriched by protein A-agarose beads (Millipore). The purified DNA was used to construct a library with the NEXTflex Rapid DNA-seq Kit (PerkinElmer).
-
bioRxiv - Biophysics 2019Quote: Mouse neuroblastoma x rat neuron hybrid ND7/23 cells (ECACC 92090903, Sigma Aldrich) were grown in high glucose Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Neuroscience 2022Quote: Mouse neuroblastoma x rat neuron hybrid ND7/23 cells (ECACC 92090903, Sigma Aldrich) were grown in high-glucose Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... S9.6 antibody that binds to RNA/DNA hybrid was purchased from Millipore (MABE1095).
-
bioRxiv - Bioengineering 2020Quote: ... This was achieved using Red Blood Lysis buffer (Sigma-Aldrich, hybrid-max™) which preferentially lyses RBCs from a mixed population of cells ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore, Burlington ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore, Burlington ...
-
bioRxiv - Genomics 2022Quote: DNA (0.5-1µg) was bisulfite treated using the two-step protocol of the Imprint DNA Modification Kit (Sigma). converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN) ...