Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Toll Like Receptor 3 TLR3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Developmental Biology 2022Quote: ... The activin receptor-like kinase (ALK5)/ type I TGFβ-receptor kinase inhibitor SB-525334 (Sigma) was used at a concentration of 50µM ...
-
bioRxiv - Neuroscience 2021Quote: ... and D2-like dopamine receptors (Sulpiride, Sulp; 10 μM, Sigma, substances were applied for at least 15 min prior STDP recordings) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using bonafide GABA-A receptor agonists like GABA (Sigma #A2129), Muscimol (Sigma #M1523) ...
-
bioRxiv - Cancer Biology 2021Quote: ... as well as GABA-A receptor antagonists like Bicuculline methbromide (Sigma #B7561) and Picrotoxin (Sigma #P1675) ...
-
bioRxiv - Neuroscience 2023Quote: ... GluR2/3: Anti-Glutamate Receptor 2 & 3 antibody (1:500, Millipore, Cat# AB1506). c-Fos ...
-
bioRxiv - Neuroscience 2020Quote: ... we applied either dopamine or the D2-like receptor antagonist eticlopride (Sigma-Aldrich Spain) iontophoretically through multi-barreled pipettes attached to the recording electrode ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μM TLR3/dsRNA Complex Inhibitor (Millipore Sigma), or 0.1% DMSO for 30 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... The TLR3 signalling inhibitor (EMD Millipore, Cat. No. 614310) was used at 27 μM and anti-human IFNAR2 antibody (PBL Assay Science ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-Glutamate receptor 1 antibody (Millipore – AB1504); Anti-GluR1-NT (NT ...
-
bioRxiv - Neuroscience 2020Quote: ... The TRPV1 receptor agonist capsaicin (3 μM; Sigma-Aldrich, M2028) was applied at the end of experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... The following inhibitors were used: TLR3/dsRNA Complex Inhibitor (Sigma) 30 μM ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-oligomer antibody (anti prefibrillar oligomer-like material; Cat #AB9234, Merck-Millipore) or anti-murine amylin (in-house derived ...
-
bioRxiv - Evolutionary Biology 2021Quote: pET-Duet-Toll-9 full length clone was transformed into BL21 (DE3) (Novagen) for the expression ...
-
bioRxiv - Neuroscience 2019Quote: ... Sheared crosslinked chromatin was immunoprecipitated separately with an anti-AR antibody (3 μg, 17-10489 ChIPAb + androgen receptor Assay Kit, Millipore) or an equal amount of normal IgG (3 μg ...
-
bioRxiv - Neuroscience 2019Quote: ... the membranes were incubated with guinea pig antibody to D1 receptors (1:400; Alomone, Jerusalem, Israel) and rabbit antibody to D2 receptors (1:500; Millipore, Burlington, MA), washed ...
-
bioRxiv - Neuroscience 2020Quote: ... and (3) GluA2 (mouse anti-glutamate receptor 2; Millipore; used at 1:2000). Cochlear pieces were incubated in species appropriate secondary antibodies coupled to Alexa Fluors in the red ...
-
bioRxiv - Physiology 2022Quote: Drugs used throughout studies include MSX-3 (A2A receptor antagonist; #M3568; Millipore Sigma), ketanserin tartrate (5-HT2A/C receptor antagonist ...
-
bioRxiv - Molecular Biology 2022Quote: ... antibodies against Epidermal Growth Factor Receptor (EGFR) (Millipore, 06-847) were used at 1:200 dilution at 4°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... Relative TLR3 protein expression levels between WT and CRISPR modified cells were obtained by measuring TLR3’s expression against the intracellular β-Actin control protein bound to an anti-β-Actin monoclonal antibody (1:300; Sigma). Protein detection in WES was accomplished according to the manufacturer’s protocol using streptavidin-HRP based methodology (ProteinSimple) ...
-
bioRxiv - Neuroscience 2019Quote: ... or an equal amount of normal IgG (3 μg, androgen receptor Assay Kit, Millipore). After decrosslinking and DNA purification ...
-
bioRxiv - Cell Biology 2023Quote: ... Horse Radish Peroxidase (HRP) conjugated secondary antibodies like goat anti-rabbit (Millipore, AP307P, 1:3000), goat anti-mouse (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... Glucocorticoid Receptor antibody (#3660, Cell Signalling Technology) or control IgG antibody (#03-198, Merck Millipore) and incubated for 1 h at room temperature whilst rotating ...
-
bioRxiv - Neuroscience 2020Quote: ... Receptor antagonists used this study included: NBQX (AMPA receptors: Sigma), MK-801 (NMDA receptors ...
-
bioRxiv - Cancer Biology 2019Quote: ... Anti-Interferon-α/β Receptor Chain 2 Antibody (IFNA2, clone MAB1155; Millipore) and its corresponding isotype (Mouse IgG2a ...
-
bioRxiv - Physiology 2020Quote: ... p-Insulin Receptor Antibody(p-Thy1162/1163) (Calbiochem 407707 or Sigma I1783), phospho-CaM KinaseII (Cell Signaling #12716) ...
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit anti-mu opioid receptor (MOR) antibody (1:1000; EMD Millipore: AB5511) was applied at 4°C in 1x PBS containing 0.25% Triton-X-100 (PBS-Tx ...
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies used included rabbit anti-P2RY12 (Purinergic Receptor P2Y12; Sigma Prestige Antibodies ...
-
bioRxiv - Immunology 2023Quote: ... MDMs were also pre-treated for 1h with a TLR3/dsRNA complex inhibitor (Merck Millipore) 5 µM final concentration ...
-
bioRxiv - Cell Biology 2019Quote: ... Bcl2/Adenovirus E1B 19 kDa and protein-interacting protein 3-like (BNIP3L/NIX) from Sigma-Aldrich (St. Louis, MO, USA), perilipin (PLIN ...
-
bioRxiv - Cancer Biology 2021Quote: For activation of the Toll pathway cells were pretreated for one hour with 10 μg/ml LPS (Sigma) or 5 μg/ml poly(I:C ...
-
bioRxiv - Neuroscience 2023Quote: ... 0,005 CPP [()-3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid] (NMDA receptors antagonist, Sigma Aldrich). Traces of whole-cell voltage-clamp recordings (holding potential ...
-
bioRxiv - Plant Biology 2019Quote: ... in this case TraesCS1D01G436500 (Sigma 70-like family) and TraesCS4B01G383400 (HSF family) ...
-
bioRxiv - Cell Biology 2022Quote: ... a mouse anti-GABAA receptor β2/β3 subunit antibody (Millipore, catalog #: 05-474), or a mouse anti-His antibody.
-
bioRxiv - Neuroscience 2019Quote: ... strychnine (glycine receptors; Sigma), 4-AP (K channels ...
-
bioRxiv - Neuroscience 2020Quote: ... strychnine (glycine receptors; Sigma). Acetylcholine receptors were activated using the non-selective cholinergic agonist ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from tendon-like constructs (n=4 animals, 3 constructs each) using TRI® Reagent (Sigma-Aldrich; Vienna, Austria) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Receptors were surface labelled by addition of M1 anti-Flag antibody (1:1000, Sigma) conjugated to Alexa 555 (A10470 ...
-
bioRxiv - Neuroscience 2024Quote: ... and rat anti-muscarinic ACh receptor m2 (M2R) antibody (1:500; MAB367, Sigma-Aldrich) at 4 °C for 24 h on a shaker ...
-
bioRxiv - Cell Biology 2022Quote: ... 25nM fMLP (for neutrophil-like cells, F3506-5MG, Sigma) or with 10kD FITC-dextran ...
-
bioRxiv - Immunology 2021Quote: ... Human fibroblast like synoviocytes (HFLS) purchase from Sigma-Aldrich were cultured and maintained in synoviocytes growth medium (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... a histrionicotoxin-like compound (HTX, ENAH2C55884A-50MG, Sigma-Aldrich), indolizidine (indol ...
-
bioRxiv - Neuroscience 2022Quote: ... AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptors were blocked using 6,7-dinitroquinoxaline-2,3-dione (DNQX, Sigma) dissolved in dimethyl sulfoxide and diluted by 1000 in aCSF for 10μM bath application.
-
bioRxiv - Neuroscience 2019Quote: ... GABAB receptor agonist baclofen (Sigma), antagonist CGP-52432 (Tocris Cookson ...
-
bioRxiv - Neuroscience 2019Quote: ... MK-801 (NMDA receptors; Sigma), SR-95531 (GABAAR ...
-
bioRxiv - Neuroscience 2020Quote: ... MK-801 (NMDA receptors; Sigma), SR-95531 (GABAAR ...
-
bioRxiv - Neuroscience 2023Quote: ... strychnine (glycine receptors; Sigma-Aldrich).
-
bioRxiv - Neuroscience 2024Quote: ... D1 receptor antagonist) (Sigma-Aldrich); L-741,626 (10 mg/kg ...
-
bioRxiv - Cancer Biology 2020Quote: The chymotrypsin-like proteasome activity was measured by Sigma-Aldrich kit (cat# MAK172 ...
-
bioRxiv - Cell Biology 2020Quote: ATDC5 mouse chondrocyte-like cells (Sigma-Aldrich, St. Louis, MO) were cultured in normal medium consisting of Dulbecco’s Modified Eagle Medium (DMEM ...