Labshake search
Citations for Millipore Sigma :
1 - 50 of 2440 citations for STAT3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... STAT3 (Millipore, Solna, Sweden); collagen I (Acris Antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... STAT3#2 (#HA13744332, Sigma), JAK1 (#SASI_Hs01_00174612 ...
-
bioRxiv - Genomics 2019Quote: ... Cells were then incubated with a STAT3 antibody (9139, Cell Signalling) in blocking buffer + 0.1% tween-20 (P1379, Sigma Aldrich) for 1-2 hours at room temperature or overnight at 4°C on a shaker ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit polyclonal STAT3(06596; Sigma-Aldrich)
-
bioRxiv - Cell Biology 2022Quote: ... Integrin-blocking (GRGDSP, #SCP0157) and negative control (GRADSP, #SCP0156) peptides were purchased from Sigma. Recombinant human integrins αvβ3 (3050-AV) ...
-
bioRxiv - Cancer Biology 2019Quote: ... RP (5’AAGGTGAGGGACTCAAACTGC) for STAT3 (Sigma-Aldrich) and FP (5’-AGAAGGCTGGGGCTCATTTG) ...
-
bioRxiv - Cancer Biology 2021Quote: The siRNAs targeting STAT3#1 (#HA13744330, Sigma), STAT3#2 (#HA13744332 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Phospho-STAT3 was inhibited using WP1066 (Sigma, #573097) and S3I-201 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 5ug of antibodies (rabbit anti-mouse Stat3, Millipore 06-596 ...
-
bioRxiv - Cancer Biology 2022Quote: STAT3 was depleted using the shRNA construct (Millipore Sigma): Gene ...
-
bioRxiv - Bioengineering 2020Quote: ... 5 μM 5,15-diphenyl-porphine (STAT3 inhibitor; Sigma-Aldrich # D4071), 10 nM GSK2110183 (AKT1/2/3 inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA for STAT3 was purchased from Sigma Aldrich (NM_012747). The optimal conditions and concentrations of siRNA for beta-cell transfection (30nM ...
-
bioRxiv - Immunology 2021Quote: ... STAT3 activation was inhibited in vitro using Cpd188 (Sigma-Aldrich,UK) at 73 μM.
-
bioRxiv - Microbiology 2023Quote: ... After blocking with blocking buffer (Sigma, DUO82007), the cells were incubated with mouse anti-IRF3 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2024Quote: ... CoREST2-FLAG overexpression (VectorBuilder) and knockdown of STAT3 (Sigma, SHCLNG-NM_003150, TRCN0000329887), JAK2 (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... (AGP-001 and ACC-003, Alomone), blocking peptide for Anti-CaV1.2 (CACNA1C) (BLP-CC003, Alomone) and β-ACTIN (A1978, Sigma-Aldrich). Secondary antibodies used for the immunoblots were Mouse-HRP (115-035-003 ...
-
bioRxiv - Cancer Biology 2022Quote: ... BMDCs were treated with the STAT3 inhibitor Silibinin (1 μM, Sigma-Aldrich; S0417)) ...
-
bioRxiv - Neuroscience 2020Quote: HFIP treated Aβ42 peptide (JPT Peptide Technologies) and Aβ42-1 reversed peptide (Sigma) were dissolved in DMSO ...
-
bioRxiv - Developmental Biology 2020Quote: ... Blocking was performed in Millipore blocking reagent (EMD Millipore), followed by incubating the section in Anti-GFP (ab13970 ...
-
bioRxiv - Microbiology 2023Quote: ... followed by blocking with 1x casein blocking buffer (Sigma) for 4 hours at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: The wild-type and stat3 mutant zebrafish was euthanized with tricaine methanesulfonate (MS222, Sigma) and fixed using 2.5% glutaraldehyde (diluted in PBS ...
-
bioRxiv - Immunology 2021Quote: ... were isolated from either naïve or infected or tumour-bearing HHD or BALB/c mice and were cultured in the presence of HLA-A2 restricted IAV M1 peptide 158-66(GILGFVFTL)(Cambridge peptide) or NY-ESO-1 peptide 157-65 (SLLMWITQC)(Sigma peptide) or H-2Kd binding IAV NP peptide 147-55(TYQRTRALV ...
-
bioRxiv - Immunology 2019Quote: ... RGD peptide or as control GRADSP (RAD) peptide (SIGMA) was injected via Wharton’s duct cannulation (approximately 600 nmol of either peptide in 30 µl per lobe in PBS) ...
-
bioRxiv - Genomics 2020Quote: ... a saturation step was performed with blocking solution (blocking reagent Sigma #11096176001 ...
-
bioRxiv - Immunology 2022Quote: ... After blocking with IHC Select Blocking Reagent (Millipore, cat. 20773-M) at RT for 2 h ...
-
bioRxiv - Cell Biology 2019Quote: ... FLAG peptide (Sigma) was applied to the column to elute the FLAG protein complex according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... SIINFEKL peptide (Sigma), and human CD4-Fc fusion protein (generated in-house at Genentech ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG peptide (Sigma) was applied to elute the Flag-labeled protein complex as described by the vendor ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stat3 knockdown cell lines were generated by transducing cells with lentiviral shRNA (TRCN0000071456, TRCN0000071454, TRCN0000071453, Sigma). Lentiviruses were generated using 293T cells via transfection with PEI and appropriate vectors ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound peptides were eluted with 400 μg/ml Flag peptide (Sigma) in BC100 buffer for 20 min on ice.
-
bioRxiv - Developmental Biology 2020Quote: ... Blocking was carried out in freshly made blocking buffer (5% FCS, Sigma-Aldrich, Gillingham ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by blocking in blocking/permeabilization solution consisting of 10% Donkey Serum (Millipore) or 1% BSA and 0.3% Triton X-100 (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocking/ permeabilization was performed using blocking buffer consisting of 5% BSA (Sigma-Aldrich), 0.5% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Blocking was performed in 0.5% Roche Western Blocking Reagent (CAT 11921673001; Sigma-Aldrich) and 5% heat-inactivated horse serum (CAT 04-124-1A ...
-
bioRxiv - Immunology 2023Quote: ... The protein was then eluted in 15 μL of peptide elution buffer three times using Flag peptide or HA peptide (Sigma) 300µg/mL ...
-
SIMON, an automated machine learning system reveals immune signatures of influenza vaccine responsesbioRxiv - Immunology 2019Quote: ... Influenza peptide pool contained 483 peptides (20mers with 11aa overlap, Sigma Aldrich) spanning the entire influenza proteome from the influenza strain A/California/07/2009 (dissolved in DMSO at 20mg/ml ...
-
bioRxiv - Plant Biology 2024Quote: ... and flg22 peptides as a peptide control (obtained from Sigma (MO, USA)) ...
-
bioRxiv - Cell Biology 2021Quote: ... Serum blocking was performed for 20min at RT in 1xWBR (Western Blocking Reagent) (Sigma) solution ...
-
bioRxiv - Neuroscience 2023Quote: ... a blocking step using blocking solution (1% (w/v) bovine serum albumin (Sigma A9418), 5% (v/v ...
-
bioRxiv - Neuroscience 2020Quote: ... Aβ42 peptide (A9810, Sigma) was prepared in DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... or HA peptide (Sigma) resuspended in lysis buffer + 1% NP-40 ...
-
bioRxiv - Cell Biology 2021Quote: ... A FLAG peptide (Sigma) was applied to the column to elute the FLAG protein complex ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptide-18 (Merck Millipore) was recovered in water at a stock concentration of 1 mg/ml and microinjected in the oocyte cytoplasm.
-
bioRxiv - Physiology 2023Quote: ... Peptides and 20E (Sigma) were frozen as aliquots of 200 pmol/μl in water and 2 µg/µL ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG peptide (Sigma, F4799), and anti-FLAG agarose beads (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... After auto-fluorescence blocking (Millipore), sections were subjected to antigen retrieval by heating at 80°C for 30 min in 10 mM citrate buffer pH 6.0 ...
-
bioRxiv - Developmental Biology 2022Quote: ... + 2% blocking reagent (Sigma 11096176001). Anti-sense DIG-labeled in-situ probes were generated using linearized plasmid cDNA templates with 10X DIG RNA labeling mix (Sigma 11277073910 ...
-
bioRxiv - Developmental Biology 2021Quote: ... + 2% blocking reagent (Sigma 11096176001). Anti-sense DIG labeled in- situ probes were generated using linearized plasmid cDNA templates with the10X DIG RNA labeling mix (Sigma 11277073910 ...
-
bioRxiv - Cell Biology 2023Quote: ... Casein-based blocking solution (Sigma) was used for anti-biotin blots ...
-
bioRxiv - Developmental Biology 2023Quote: ... + 2% blocking reagent (Sigma 11096176001). Full lengthrfx6.L and pdx1.L anti-sense DIG-labeled in-situ probes were generated using linearized plasmid cDNA templates with 10× DIG RNA labeling mix (Sigma 11277073910 ...