Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Recombinant Mouse Tlr3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
bioRxiv - Plant Biology 2019Quote: ... His-tagged recombinant protein was eluded with 250 mM imidazole (Sigma).
-
bioRxiv - Neuroscience 2019Quote: ... was incubated with recombinant His-tagged human HDAC6 protein (EMD Millipore) in 250 μl RB100 buffer (25 mM HEPES pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged recombinant proteins were expressed in Rosetta2 (DE3)pLysS bacteria (Novagen) and purified on IMAC columns (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... The production of the (His)6-tagged recombinant proteins was confirmed by Western analysis using mouse monoclonal α-His-horseradish peroxidase conjugated antibodies (Sigma Aldrich, USA). Imaging of the protein bands on the Western blot was conducted using the ECL kit (ThermoScientific ...
-
bioRxiv - Microbiology 2021Quote: ... His-tagged recombinant proteins were detected using an HRP-conjugated anti-His monoclonal antibody (Sigma-Aldrich, St. Louis, MO) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... All antibodies were incubated separately at a concentration of 10 μg/ml in tubes together with 330 ng/ml HIS-tagged CD40 recombinant protein and 4 μg/ml peroxidase-coupled anti-HIS detection antibody (Sigma-Aldrich) for 60 minutes in ELISA buffer (PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... S5H recombinant protein was examined by using specific anti-His mouse antibody (Novagen) as described in (López-Gresa et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... and His-tagged human HDAC6 protein (EMD Millipore) were incubated with 57 nm 32P-ATP in kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Microbiology 2020Quote: Female BALB/c mice have been injected intraperitoneally with 700 μg recombinant His-tagged TGT protein that was emulsified in complete Freund’s adjuvant (Sigma-Aldrich). Two weeks later ...
-
bioRxiv - Microbiology 2019Quote: ... Bound His-tagged proteins were detected using HRP-conjugated anti-His antibodies (Sigma) at a 1:500 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli cells and large quantities of His6 tagged recombinant Nbs were purified with 1ml of HIS-Select Nickel Affinity Gel (Sigma-Aldrich) following periplasmic expression through osmotic shock ...
-
bioRxiv - Microbiology 2022Quote: ... These were prepared by preincubating the His-tagged PilC with mouse monoclonal anti-poly-histidine and biotinylated anti-mouse IgG antibodies (both from Sigma) at a ratio of 1:1.5:1.5 (by weight ...
-
bioRxiv - Bioengineering 2020Quote: ... The eluted His-tagged RBD was then incubated with biotin-tagged HRV C3 protease (Sigma) and passed through a streptavidin-agarose column to deplete the protease and the 8XHis-SBP peptide ...
-
bioRxiv - Systems Biology 2021Quote: ... separated proteins were transferred to a PVDF membrane using a semi-dry system and His-tagged proteins (hCDKL5 and His-Neuropilin) were detected with a HRP-conjugated anti-His antibody (1:2,000, Sigma) using the Enhanced Chemiluminescence kit (ECL ...
-
bioRxiv - Microbiology 2021Quote: N-terminal His-tagged recombinant proteins were expressed in Rosetta™ 2(DE3) pLysS competent cells (71403; Novagen, Inc., Madison, WI, USA) by induction with 0.5 mM isopropyl β-d-1-thiogalactopyranoside at 30°C for 4 h (N ...
-
bioRxiv - Microbiology 2023Quote: N-terminal His-tagged KtrD cloned into pRSFDuet-1 (Novagen) was overexpressed in Escherichia coli BL21 (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... 25 uL of (His)6-tagged TEV-protease (Sigma-Aldrich) was added and the solution incubated overnight at 4°C.
-
bioRxiv - Molecular Biology 2021Quote: ... Fractions containing His-tagged protein as verified by Western blot with an anti-His antibody (Sigma) were pooled and loaded onto the StrepTrap column ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were purified with His-Bind Resin and His-Bind Buffers (Merck Millipore) according to manufacturer’s protocol and stored at a concentration of 2mg/ml in elution buffer (Merck Millipore ...
-
bioRxiv - Biochemistry 2021Quote: Genes for His-tagged or Strep II-tagged nanobodies were cloned into the pET 26b vector (Novagen). The expression and purification of all His-tagged nanobodies have been described previously 12 ...
-
bioRxiv - Cell Biology 2020Quote: ... His-tagged proteins were immobilized on Ni-NTA His-Bind® Superflow™ Resin (Merck Millipore, 70691), washed and eluted in SB buffer (30 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 6×His-tagged protein were expressed and purified by Ni-NTA His Bind Resin (Millipore 70666-3). ∼0.2 μg of GST-OsBZR1 ...
-
bioRxiv - Biochemistry 2020Quote: ... or 15 U/mg His-tagged SUMO protease (Millipore Sigma SAE0067) by overnight incubation at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... recombinant His-Akt1 was from EMD Millipore (#14-279); recombinant GST-mTORf (containing a 30 fragment of mTOR encoding amino acids 2144-2175 ...
-
bioRxiv - Biochemistry 2022Quote: ... His6-tagged proteins were purified with Ni-NTA His-Bind Superflow (Novagen) and dialyzed against PBS using a Pur-A-Lyzer™ Midi Dialysis Kit (Merck).
-
bioRxiv - Cancer Biology 2020Quote: ... 100 ng recombinant His-AKT1 (inactive, Upstate/Millipore #14-279), at a final volume of 30 μl ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant Ded1-His was expressed from the pET22b plasmid (Novagen) and purified as previously described (46) ...
-
bioRxiv - Plant Biology 2024Quote: ... His- and GST-tagged proteins were detected with anti-His (Monoclonal Anti-polyHistidine antibody, Sigma H1029, 1:5000 dilution) or anti-GST (Mouse anti-GST monoclonal antibody ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μM TLR3/dsRNA Complex Inhibitor (Millipore Sigma), or 0.1% DMSO for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Wells were washed thrice with PBST and monoclonal primary antibody (anti-his-tagged mouse antibody, 1:5000 diluted, Sigma-Aldrich, USA) was added and incubation was continued for 1 h at RT ...
-
bioRxiv - Biophysics 2019Quote: ... as a Tobacco Etch Virus (TEV)-cleavable N-terminal His-tagged (6×-His) fusion protein using a pET46 Ek/LIC vector (Novagen) and purified using Ni-NTA affinity chromatography and gel filtration chromatography as previously described (Hughes et al ...
-
bioRxiv - Biophysics 2021Quote: His-tagged human PCNA protein was purchased from Sigma Aldrich (catalogue number SRP5117), at a concentration of 6.6 μM ...
-
bioRxiv - Molecular Biology 2022Quote: These His-tagged protein lysates were combined with 1 ml nickel beads (Sigma) and incubated at 4 °C/2 hours/rolling ...
-
bioRxiv - Plant Biology 2022Quote: PIF3 recombinant proteins were prepared using PIF3-his DNA (pET28C, Novagen) provided by Ferenc Nagy and induced and purified using commercial kit (Amersham) ...
-
bioRxiv - Immunology 2022Quote: ... The TLR3 signalling inhibitor (EMD Millipore, Cat. No. 614310) was used at 27 μM and anti-human IFNAR2 antibody (PBL Assay Science ...
-
bioRxiv - Microbiology 2021Quote: ... HIS-tagged B subunit of Shiga toxin 1(SML0655) and Apilimod (A149227) from Sigma; rabbit anti-EEA1 (#3288) ...
-
bioRxiv - Microbiology 2020Quote: ... His-tagged proteins were detected using monoclonal anti-polyHis-HRP conjugate (Sigma-Aldrich, CAD). Phosphorylated mitogen-activated protein kinases (MAPK ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse recombinant IFN-β (Millipore) diluted in DPBS with 0.1% Bovine serum albumin BSA (Roche ...
-
bioRxiv - Microbiology 2021Quote: Recombinant mouse adiponectin (Sigma, #SRP3297) and GFP protein (Sino Biological ...
-
bioRxiv - Immunology 2022Quote: The recombinant proteins were purified using His•Bind® Purification Kit (Novagen) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... the soluble His-tagged proteins were produced and purified after binding to a Ni-NTA His-Bind resin (Sigma-Aldrich, MO, US) as described by Martínez-Martínez (19) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The following inhibitors were used: TLR3/dsRNA Complex Inhibitor (Sigma) 30 μM ...
-
bioRxiv - Bioengineering 2020Quote: ... His tagged FLIPsuc sensors were purified by affinity chromatography using Ni-NTA bead material (Novagen). Binding to the resin was performed in batch at 4 °C for 4 h ...
-
bioRxiv - Biophysics 2020Quote: ... or 8 μM His-tagged NSP2 labelled with 8 μM Atto488-nitrilotriacetic acid (NTA, Sigma), and buffer (0.5 × phosphate saline buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The eluted His-tagged σNS was concentrated using a 10-kDa centrifugal filter unit (Millipore), dialyzed into 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (mouse, 1:3k, Sigma, A7058), anti-c-Myc (mouse ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-mouse FITC tagged (1:200, Sigma) at room temperature in dark for 90 min ...
-
bioRxiv - Cell Biology 2022Quote: The recombinant GST-tagged Nanobody against GFP69 expressed in Escherichia coli Rosettagami (Novagen, 71351) was purified with Glutathione Sepharose 4B beads according to manufacturer’s instructions ...